PRGWK00002521 (RDC0002NLR0008)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0008
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:CC, Domain:NBS, Domain:LRR
Location Start 16181060
Location End 16183491
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGTGTATAATTGTATTCTCACAAAATTATGCATCTCCTAGTTGGTGCTTGGATCAACTTGTTTCCATTCTTGAATACAAAATGAAGTTTGCATGTATGATATTGCCTATTTTCTACCATGTTGATCCTTCAAATCTGAGGAAGCACAAAGGAAGTTTTGGTGAAGCATTAAACAGACATGAAGAAAAATTCAAGTGTGAAAGAGTAGATGAAAAAGAGTATTGGGAGGACAAGTTAAAAAAATGGAAAGATGCACTGAGCCAAGCTGCTGATTTGGCTGGAATGGTCCTTGAAAATCAGTAAGTTATATTTATTCATGTATCGTCGATGTAACAAATTTTTGCGGGTTAATAGCAGGTAACCTGTCTTATTTTCAAGATTATAAAATCTCGAAAATCTTAAGGAGTGTTCTTTATTTTTCAGGCATGAATCCACTTTCATCAAGAAGGTTATTAACGTTATCAGCACGAGACTAAGTCGTCCTGCTTTATATATTGCTTCTTGTTCAATCGGAATACATCGTAGAGCTAGGCCTATTAATTCTTGGGTTCAAGATGATGGATCGAACAATTCAAATATTGGAATACTTCTAGTTTGTGGTATTGGTGGAATTGGAAAAACAACACTTGCCAAATTTGTTTACAATTTAAACTTTGGATATTTTGAAATTAGTTGTTTCTTACCAAATATTAGAGAAACATCAAAACTCCCTAATGGTCTCATAGCTTTACAAAAGCAACTACTTTCTATCCTTTTAAAGAATGAAAAGGCAAAAATATCAAGTGTTGATGAAGGAATCATCAAGATAAGAAATGCTTTATGTTATCGAAAAGTTCTTCTTGTTCTTGATGATGTTGATGAGCCTGATTTGGTTGAAGCAATATTTGACATGAAAGATTGGTTTGGATTTGGAAGTAAAATAATTGTAACAACTAGGCACAAAAGTTTATTAAGACCTCAATTAGGCCATGAGGTACATGAAGTTGGAATTTTGTACACAATTGAAGCAAATGAGCTCTACAATTTTCATGCATTTGGTAATGTAAACAATCAAATAAGCAAAGATTATTACAAAGAGTACTTAGAGGAAGTAATTGAATGGTGTAGAGGACTTCCATTAGCTCTTCAAGTTATCGGTTCTTCCTGTTGGGTTTTAGTAAGTGTGAATGGGAAAAGAAAAGAGACAATATGAAAAGTGAGGGAACTACTTTGGAGGAAAAATGAAAAGTCATTTGCAAAATGCAAATGAAAAGTCATTTCTCCCATATCGGCAAAAGAAATGGAAATTGTCCTTATAGAAGGAAACACTTCCATTACTTCTTAAAAGAGATAAGAAGATGTCACTCGCGCCGTCGCTCGGCTTTGGATTTGATTGATAAATTTTTTGCACAAAATTTATTTAATCAGTTTTTGTTAATATTATCTCTTATAAATTTGTGGGTAACGGTAACATTTCGAAAAGTTGTTACTTTTCCGAAAAGTTGGGTCTGAACAGATTTCACTGAACAGACATGTTCTTTGCTGAAAATGGCTATAAAAGGAAGTCAATTTTTTATTTTTCAAACACTGAAAATTTTTCTTTCTCTGCATTTATTTTTCTCTCAAATAAAAATCAAAGTGTCGATCGACTGAGTCTGTGTGACTTGTTGATGTTCTTAAGTTCGCTGAAGTTAAAGAAATTTGAGGTACTGCTATTTCTTTAACAGGTTTAATCCGTTTTATCTTGGGAGAAATTAATCCATAACCTTGGGTACAGTGAGGGAATTAAATTTCTTAAGGACTCGGATTATTTCTTGTATTTTATATTTTTTTTGCTTCATCTTATTTCTGTTTCTGTTTATTAACCTTATAAATACAGGTTATTGTAAGTATAACAATCTTACAACACTTCCATAGCTGGAAAATCAAAAGATGTATGGAGAAGTGCTATAGGAAAGTTGAGAGAAATTCCGACAAATGAAATTGTTGAGAAATTGAGATTGAGTTATGAGTTATTGGAAGATGATCATGATCAGAATTTGTTCCTTCATCTTTGTTGTTTCTTTGTGGGGATGAAAAAAGATTTTGTAGTTAGGATATTAGATAAATGTGATTTTTACACATTGGTTGGGATACAAAATCTAATTGATAGAAGTTTAGTGACAATTGAATTTGTGAATGAGATAACAATACATCAATATGGGAAGAGATATTGTTCGTAGAGAAGCAACTGTGGATCCTGGAAAACGTACTAGGCTTTGGCATCACACAGATTCTTACAATGTTCTAACAGGAAAAACAGTAAGTAATTAATCATGTTCCTAATTTTTAATATTTTGGTCATCGTCGTTATAAAAGTAGCTCATTACTGTATTTTATTTTTCTTGTGATTTATATTAGGGAACAGAGAGAGTGCAGGGGATGGTACTTGACATGCGTATGATTAAGAAATACAAGTGTTCTGGGTCCTTAATACCATTGAAACAAAGTCCAATTGGTTTTTTCACAGCTTGGAGTTCAAAAGTGGGGAATTTTAGTTTACAAGATCATGTGAGAACTGATGCCTTTGAGAAAATGCACAAGCTTAAATTTCTCCAATTCAACAAAGTTAAAGTGAATGGAAGTTACAAGAACTTTCCAAAGGGATTGAGATGGCTATGTTGGAGTGGATTCCCAGAGGAGTGTATACCAAATGAGTTTCCAATGGGAAATGTCGTTTCTATCGATATGCGATACAGCTGCTTGAAACAACTTTGGAACGGATATAAGGTAATTAATTTTCTTTCATCCTCAGTTGGGTGTCAAAAGTTAACACGAGTTGAACCATTGCATCAGTTTATAAGCCTCTTGAATTGGCCTAATCTTTTGAAATGGGCTTCTTATCCAGTGTATATTACTTATACTACGACTTTTATCAAACAAATGACTTAATTTTCTTTGTTTTGATGCATTAGTTTCTCCGGTACCTAGAGATACTGGATTTGAGCCACTCCACTGAACTCATCACAACACCGGATTTCTCAGGCCTTACCAATCTTGAAAAGTTGATACTCGAACAATGTACAAAGTTAATCAATGTTCATAACACCGTTGGATGTCTACAAAAACTCATGATCTTGAACCTTAAAGATTGCCACAAGTTAAAGATTCTTCCAGATAGCATTTGTGAGTTAAAATGTCTTGAGACACTTAACATCTCAGGCTGCTCAAACATTGAATATTTACCAACAGAGCTTGATAAATTAACATCACTAAAGGAACTTTATGCTGATGGGATCTCAATGATTAATTTGGAGGCCCAAACATGGTATTCATCTTTGTGGGCTTGGGCCTGGAAAGGAAGAGGCCCATTATTATCTCCTAAAATTCATTTTCCCAAGTCCTTACATGTGTTAAACATTGCAAAATGCAATTTATCTCCAGATGCTTGATTTAGGCATTATGACCTCACTACAATGGCTAGATTTGGGAGGAAATCCGATTGACGAATTACCAGATAGTATCAAGAATCTTACGAGGCTGAAAACTCTTAACATCGCGTGTTGTACAAAGATCAAGTACCTCGAAGGGGTACCATCAAATGTAACGGATGTAAATGCTGATGGATGTATTGGAGAAAGTAGGTTCTTGTGCTAA

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox