PRGWK00002533 (RDC0002NLR0020)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0020
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS
Location Start 1830125
Location End 1833539
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

TCAGTAGGGAATAGTGAGCTTGAATTTGCCACTTTCTGGATGATCAGCTTGCTTCTTCTTTTTCTCGCATTCTATTTCTCTTGCAGATTTGCTTGCTTTGCTTGTGTTTTCCAACGTCATCTCTTGAAGGTTATCCAAATGGGCAAGATCGAGTGGCACAGCCTCAAGATTAAGACAGGAGATCAGGAAAAGGCTCCTAAGTCTTGGGAAAGGACAGTTTGATGCCTCCCACGACACGAAATCTGCCATTTCAATCCACAAGACCTGAAGTTTCTTGAAACCTCCTGGCTCCATCCTCCAGGACGGCCCCATGAATGCATTTTCTTTCATTTTTAGGACCTGGAGATTTTTCACCTGCCCCAATCTATATGCCTGATTCCAGTCAAACCTTGTTTTTGATAGAGTTAACTTCTTCAAATTTGGTAAACATTCGGAGAATGCTGACGGAAGGTGAAGAGATTTGTTACTCTTATCATCATTTAGCAGTGTTAAACTTTCCAGGAGCTTTAGCACTTGAAAATTGCTGAAAAATTCACCCTTGCTAGTTTCAAGAAAAGGCGTCAAATTACCTTTAACACTCATTTTTTTGACATTACGAGCTTTTGAAAGAACATTTCCCTTGCAGCTTTCTGGTGTAACCAGAGATAGAGTTTGCAAAAAACAAGAATTTGTACTACTACTACTACTACTACTTGTAGGGGGTGGTAAGATTGCAGGTTTGTTGGTGCGCAGATGACGCAAACGTGGCATGTTCCATATGTCAGCTTTTATATCAAGGGTGGGCTTGGAAGTATTTAGAATGAGAGTTTGTGCATTACAGAAAGAAGTAAAGAGTTTAGGAAGTTGCTCGAAATCACCTGAGATAGCGATATACCTCAAGTGCAATAGCTGGTAAAATTCCCTGGTAATACTAAACTTGACGGATTCAATGTCTAAGACTCTCATAAGTGGAAATGCGGTAGGGATGAGCTTGACGTCGATATTAGAAAAGTCAACTTGTTTTTGTTTTGAGGAAAAACATAACAATGACCTAACATGTTCTTCAACTGTCTTTTTTGAGATGAAGTTTTGAGGAACAGATGATTGAATAGAGACACGACGACAAGTAATTGAGTTCTGTATGTCTTGATCAGATGTGAGACATACTTGTTTGAAAAGAGTCAATCTAGTAGCCTCTTCAACGCAAAACTCATGTAACATGTCGTGAACACGACATGTTTTTATTCGATCATTAGATTTCTTTTTCATCACCATCACTAAGTTCCTGTTGGCAAAGTCATTAAGATAATACTCTGCTATCTCTTCAATTTCGTTGCCTGACAACTTGGACATTATGAGTCCCTCAGCAATCCAGAGTCGAATCAATTTCCAAGCGGGGATATCAAATCCTTGAGGAAAGGCACCAAAATACAAGAAGCAAGATTTTTTTTCTTGAGGCAAATGATTGTAACTCAATCTCACAACATTCACACATCTCTGAAGTTTGTCTTCTTGTATAAGATGCTTCCCCACATTTTCCCTAACTACTTTCCAATCAATTTCACTCGTACGACCTCTTAAAGCTCCTGCAATTACCACAATTGTAAGTGGTACTCCACTACATTTTGCTACAATGGCTTCTCCATGTTCTACTAACTCAACAGGACAACGGCTAACGCCAAAAGCTCTCTTTTCTAGCAGCTGGAAACTTTCATCTCCATCCAGAAATTTCAGATTGTGGGGATATTTATTGACAGATCTAGCAATGTCTTCGTGTCGAGTGGTCATCATGATCCTGTGGGCTTTTTTGTTATCAGGGAAAACTGTCTTGACAATATCTACAACATTTGGATCCCACACATCATCCAAGACAATGAGACATTTACCTCCATTAGCCACACGCTTACGTATTTCATCAGTTATGCTTGCCTCATTTCTGTTTTTGAATTCATCAAATGAATTTGTGAACCCTTTCAGAATATTAAAAAGGATATCCCTTTTTACACACGTTGATTGTCCGATGAAAACCCAAATGTAGCTGAAAAATTCTCGCGAAATCTTAGGATCATTAAAGATTTTTCTTGCCAGTGTGGTTTTACCAAGTCCCGGCATTCCTACAACCGGGATAACATCTAGACACTCTGCTCCTTCAACCAGACGATTGATCACTTTCGTTGCTTCTTCATCAAATCCAACCACTTCGTGATTTTCCAATGACGAACCCTGTAAGATGGACAAATTAAACAAGTTATTAAGGCTACTTGTCTTGATTGTATCATCATAACAAGAAATTATTCCATCAGGTACCAAATGAGTTATGATCATGTGAAAGTTATTAATTTTCAATGTCCCATTCAACTATGGAAAATATGTCCCCTTATCCTATGCATGTCTATTTTATTCTTCATATTTTCAATCCCCATCATTCACTACAAGAAAAATCGGTGGTGGTAATGACTAATGATAGTGATTGTGTGTATCGATTTTAGATAGTGTTGACAGATGATAGTGGTTGTGGACGGGCTTAGTGATTAATTGTGGTTGTTGTTGGTGACCATTTGATAATTAATAGTGGAATGATACCGACAGTTAATGATAGATAGAGGTAAGCGATATATAATGTTGACCAATGGTGGCAATTATCGACAGTGATTTGTGCATGTAATAATGGTTGGTGGTGACCTTTAATTGTCTGAATTTCAGAGACACACCTTAACTAAAGTAAAATTCTACGGAATTTGAGTCATAATCTAGAAAGGTACTTCTTCCCTTTGCCTTACTTATGCCTTGTCCTAGATCTGAATAATTTAGATTAAACTTTAACTAAGTTCAAACAAATAATGCATATTAAAACAGAGGAAGTACTATTTCTCCAACTCTTATACAGTTTTACTAAACGAGCAAATCATAGTTCATTTCATATTTCAATAAATCACATTAAAATCGAGATTTCGTGTAAACGTACCTGTTCCTCCTGGACAACTTTTTCAGGCTGATGATGATCAATCGTCGGGTTTGCCTCAAACAGATGTTGATTTTCCTCAAGGATTTTCCTCACCTCTACAAGTATCTCATTGATTTCCTCAGTAAAATTCCTGTTTTTGTAAGTTTTGTGAAACATCTTTTTAGCTATATTACTCTCTTGGTCTAACTTGCCCTGAATCAATAATTTATCAACAACATCCTCTGCTTTATATACTGTACGTCGAATTTTATCGACTAGTACATCCCATTGCGTACTATTACTTCTCTGATTCGCGTTATCGACTAAAAATGCATTTAATCGCTTCACTTCATCATACAAATCTTCGCATGATTTCTTCAATCCTGTATACAACTTCCAATTATAACTTATAAGATGCGACAAGTTCTCCACCAGAAGGCTCACCGTGGCTGTCACCGCAGTGGTTAATGCAGCGGCCGTAAACGGATCCAT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox