PRGWK00002539 (RDC0002NLR0026)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0026
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:CC, Domain:NBS
Location Start 17241733
Location End 17242254
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGGTCACTATCTTCAAAGAATATAATGAGAGACAAATGCTTCTTGAAGTTGTCTCTACCATTACAAGAAGCAATCAAGAAATGAGAGATGATCAACTAACGAAGATCGTTTAAAGAGGTCTGGAGGGTGAGAGATTTGTAATTGTAAAAGATGATATATGAAGTACTGAGTCATGGGACCAAATTCAAAGAATATTTCCAAATAATTACAATAGAAGACAATTTATGTTAAACATTGGGCTCTTGTATGGTGCTAATTATGTTAGTTGTCTTGATTTTTTACCTCATGGAAAGCCTTTATAAGTCTTGATGGTAGTTTGAACTTCACCAAAAAAAATTATCAAAAAAGATTTGTTTCCTCCTCTACGTGTACAACAAGGAAAGCATATTGTACTACAACGTCAAGGATTACCTCTTTCGATTATTGTTGTTGCAAGACTTCTTGGTCAAATGGACCCAACACATGCTAATTGGATGAATGTTGAGGAAACTGAACTGATTCTTGGTATTGTATCTGAATAG

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox