PRGWK00002549 (RDC0002NLR0036)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0036
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS, Domain:LRR
Location Start 5916016
Location End 5917776
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

TTAGGCTGATTCAACAAGTGATTTTTTGCATTCCCTCACCTCAATTGATTTTAGAGTCATCCTGTCTTCAAAGCGAGAAGGGATCTGCTCAATATGTCGCAATTTTGTTAACACCAAGTGCTCAAGGCATTGGAAAGCATCATCTGAACATTCCATTCAAGAAAAGAAAGATCTTGCAGTTTCAAGAATTTTAGGAGACGGAAATGCTCATTGGTCACTTTCCATACTTTGGAATTAATGGAAACATGTAGCAGTTTGAGTACCACAAGTTCGGGGAAGGTTGAGATCTCATCAAGACTAGATATGCAACCTCTGGATAGTGTTAATTTCTTGAGACTCGGTGGTAACTTCAGCTTGAGGGTCCCCGGACCTCCACGACCCCAAGTAAACTTGAGCATTTCAAGTTTAGTAAGATTGTTAAATGCAGGGGAATAGGAATCACATGAAAAAACTTCACATCTCAATTTTTGAAGATTTGGCATCTCTGCGAAAACCCTGTCTGCATCTTCCAGACAAGAAAGCCATGCAGAGGAAAGAGTCCTCAAGCCATCCATTTCTCGGAGTGCATTGTTCCTATTGAAAATAGCGCGGTTGTATGTGTAAATGGCGCAACTTGACCATCCTCCAGAGGGTGTCTGGTAAAGTTACTCGTCCTCCAAGTCCTTTAACTATTAAAGATTCAAGGTTCCAAAGATTGTCCGAGAATGATAATGAAGAATCTTCAGCAACCTTAACAGTAACATATCTCAAGCTGGTTAACGCTGTTGGGAAAGAATCAATTACTGTGAATTCCAAATCTAGCACCCACAGGAACTTGAAACTGTTAAAAGTGTGTGATGCATAGCCTATTGATGATAATCCAATTTTTCTTCCCTTCATCAAGTGGAAAGATTGTACATTTGAACAAATAGAACTTCATTCTCCAAGATTATCACCTTGAAAGTGAAGACATAATCATCGTGGAATGTTATGCTTCTGATAGGAAATACAAGTAGGATCCATATCATTGTCCCTGTTGATAGAGAAATTTGTATACATTTAAAAGATAAAAATTGATTCGACGAATTAAAATATAAGATTGTATTACCCTTTTATGCATTGCAGAAAGTTCTCGAGCTTGGCTTTCTTTTAACAAAAATCAAGCAACAAGTCAAGAATGCGGCATGCCTTAGTCTTACCATCACAACTCTTCTTGGAAAACATCACAAGGTTTCTTCCAATAAGGTCTTTTAAGTGATGTTCCACTATATCCTCGGAAAGCTTCTCTTTATGGGATTTTACCAAACCTTCTGCTGCCACAACCATGTTAACTTTGAAACTTGTATATCTTCATCCTCCAAAAATACTCCAAAATACGAAAAACAAGGTTTGAAATTGAAATGGTAAAACTTGGTAACTAAGATTTATTATATCCTCCGTCTTATCCTGGATGTGTGAGCCTAAAAAATCTTAGCCTGTGGCCTTCAAGCTGAAATTACCACCAAGTCTCAAGAAATTAACACTATATAGTGGTTGCATAACTAGTGTTGATGAGGTCTCAACCCTCCCCGAACTTGTGGTACTCAAACTGCTACATGTTTCCATTAATTCCAAAGTATGGAAAGTGACCAGTGAGCATTTCCACCGCCTCAAATCCTTGAAACTGCAAGATACTTCTTTTTTTGAGTGGAATGTTTCAGATGATGCTTTTCCAAGCCTTGAGCATTTGGTGTTAAGAAGATCGCGACATATTGAGCAGATCCCTCCTTGCTTTGAAGACAT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox