PRGWK00002578 (RDC0002NLR0065)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0065
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:CC, Domain:NBS
Location Start 67264782
Location End 67267352
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

CTATTTCTGTATTATTGGTGTCAAGTTAGATGCAGGTAAATACTCAAAAACAAAACATCGGAGTTTATTTCTACTTACTTTGATAATGAGGTCAATACGGTCGTTTCCTTCATTCTCTTCAACATCTTTCTTAATCCTCACAGCTGAATCCTCCAGAGATTTGTTCTTGCAGTGAACCAACTTAATCTGTTTCAGTGTTGGAACATCTGCAAAGCTAATGGGGATTTCCTCGAGGTTATGGCACCATCTTATAACGATTGTTTCAAGCAGGGGAAAGGATTCCTCCGAGACATCCCACCTTGAGATATCTAACTGCACCAGTTTCAACAACTTGAGTTTATGAAACGTGATATCTCCAAGGCACCATTCTGATTGAGGAAAATACATATTTGTTAATTGAAGATACTCCAGGCTTGGTAGTCCAGCAAAGAAGGAAGTTAGGTTTTCTAGATCAGCGTCTCTTAGTACCAACATCTTTAAATTTGAAGGCAATTGTAACCCAGATAGCATGTGGAACAACCTAAAGGAAAGGTCAAGTATTTGAAGCTGGGTAAGATTCTCCAATGTGAGCCAAAGAGGTTCTGCAAAAGATCCAAATTCGATTTGAAGTTGTTGAAGATTAGGACACCTCCTTGATAACACATCCGCCCTATCAATTGGAAATCCAACAATGTTCTTTAATATCCTCAAATTTTCCAATTTAGAGGATCCTTCAAAGAGCCCCTGCTTATCAAATTCAGCATCATTGATCTCAACATGCCTTAATTGTTCCATTTCCCAAAAACACCCTCGTAACATAACTGATCTATCATTCTTCACAATTAAAGTTTCAAGATGGGGCAGATGTGATTCTCGATCAAAATAGAACGTAGTTGCCCTTACTCCGAGGTACTTCAGGTAATTAAGTGGTTTCAGTGTAGCTGAATTCACATAGTCAACTTCATAGGAACTCAAAACCAAGACCTTAAGAAGTCGCAAATTATGAATCCAAGAACTTAAGGACATTATATAAAAAGATGCTCCGTTCGTTATCAGTGACCTCAACGGTTGATGGGAACACTTCCTTGTTTTGGATGCAAACTTGGAATTCTCTTCAATCAAATTGAAGCTCACTCGACTTTGCTTCCAAACAAAAGATTGAAATTGACTATGATTTCCCTTCGCAACCAACATAAAATTTTCTTCTCTACTCTTCTCCAAGCAAAAGTGAAGCACTACATCATGAACCTCACAGTATTTGATCTTGCCATTATATTCTTTCTTTGAAACCATTACCACGTTACTGCTAATGAGATTCATCAAGTAATCTTCAGCAGATTTAATGTTCTGAACGAAGTCTTCCGCTAACCATAAACTTAACAATGCAGACACGTTAATGCTTGCATCCTCCGGAAACATCCCCATATAAAGAAGACAAGGTTTTAAACAATCAGCTAAGTTATCAAAACTCAACTGCATAGTAGCCCGACTATATTGCTCTGAATGACAATCAAGATAGTCAAATAAAGAATCTTTCACCTCATTCCACCAAGATTCTTCCAGTTTCCTTGTTTTGATTATTCCAGCTACCAAGACAATCACTAGAGGCAGTCCCTTGCATTTTTCTGCAACTACTTGACTTACATCTTGTAGTTCAGGCGGACAATCTTCCTTTTGAAAAACTTTTTTCTGCAACAATTTGCAACTCTCTTCTTTTGTGAGGAATGGAAGAGAATAAGGATCAGTATGGAACTTGACTTGTTCGCCCACTTTCTCAAGTCGAGTTGTTACTACTATTCTGCTTCTATTTCCAAAATCTGGAAAGGAAAGCCTTAAGTCATCCCATGCCATACAATCCCACATATCATCCAAGACAATGAGATATCTCTTTCCCATTAAGCTTTTCCTCAACTCATCAGCAAGGATATCATCCTCATATCCCTTGTCCTTGGAACCGGTAACTTGACTCAAAATCTCTTGTAATAGCTTTCTCCGGTTATATGTTTGGGAAACGATGCACCATGCTCGAACATCAAAATGAGAAACAATGTTGTCACTATTGTACACCTTTCTAGCAATTGTGGTTTTCCCTTGTCCCCCCATGCCTACAATTGGGACAACGTCTAGATCATTTGTACCTCTAATCAGACACTGAATTATTTTTTCTTTGTCAATCCCAAAACCCACTATCTCCTCATCAGTAATGGGATTGCTATGACGAGTTGGCAGGTGTTTAAATGGTGCAGCCACATAGTGAGGATTAAGAGGAATGTCCGCTGACCACATCTCGGTTACCTCTGCATTAATTTGCTTGATCTCTTCTACGATTGTTGGAAGTGAGCAAAAACAATGCCAAAAAACATTATATTTAGCACAAATAGAGTCAATGGAAACCCCAGCTTCATATGCCAAATTGATGGTACGTCTTTGAAGATCTTTATGTTCATGGTGCACCTTTGTGACATCTCTGAAAATGGATGATAAAGATGACAACTCCTTCTCTAAATTGGATATAAGAGTTGATTGCTCTTTCTCCAAATTACAGTAAATAGGTTTCATCAGCAAATCTAAACCATATTTAGATCTTGACAT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox