PRGWK00002581 (RDC0002NLR0068)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0068
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:CC, Domain:NBS
Location Start 4976523
Location End 4978208
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

TCAATATATGTGTCTCAAACTTATTATATTTGCCATTTCTTCTGGAACTTTTCCGAGTGAAAAACAGTTTTTGACTCTAAGTGTTTGCAAATTGTAGAGCTTGCAAATGGAGTTGGGCTAGGTTGTGATTTTAGGGTTGGAGAGATCAAGATATCTGAAGAATATTAGCTTGCTGATTTTGCCTGATAACTCCACGATGCCTGATCCGGACAAATTTAAGACTCTCAAGAACTGAAAGCTCAATAGCATATCATAAGATATATTTCTTTTCTAGAACAATGTGCACAAACGTCCTGACTCATTTATCATGTCCATTTTATCACTTGGTGAGACCCATCCAATGTATCCAACTTGAGAAAGTTTTTCTTCATCATTGCCCTTCGAATCAAATAGTTTAGATTTTAAGATATCTCCATCAAAATCGTGCATCTTATAGTACTTTATATTGTTGTGCTCCTCTAGCTCAACATATTGCAGCAAGGAATTTTGCAATAGGATTTGTAAAAAATTGTGCCCAACATCTTCTATCACGGTGGTCTCTTGATATGGATGGAGAAACCCTTCTGCCATCCAGATTCGGATAATTTGTTCCTTTTCAAACACAATCTTTTGGAAACATTGCAAAGTAAGAAAAACATTTTTAAAGATATGGTGATGGTAGATAAACATAGCTGAGTTTTAGGATTTCCTTTAAGCTATTCTCTCCATTATCATGTTCACCTGCAACAATTGGGTTCCCATCAAGAATAGTCCACCATTCATGTTTCTCCTTGTTGCGCAACAGGCCTCCCAACACACTTGCTCCAAATGGTAGACCTTTTCAACAATCCTATTCTTCACGCTCACTATTTCTTCCGGATCTTACCCACCATAAAATGCTCATTGTTTGAAAATCGACCAACAATGATCATTCGCTAATTTTTCGAACATATGAAGGCCTACTGTCGCTACTGTGGATGCCTCCAGCTTCATACGAGTCATCACAAGAATGCAGTTTCCTCTGGATGTGTTTACTCCTCTCAAGCTGTCGATGAACTCATCCCACACTGGAAGGTCAAAACTCCACAAATCATCTAAGACAAGCAGATATATTTTTCCTCCTAGTTCATCTCGGAATTTCTTCACTATTATATCCCTGGTATGGACCTCAAGTTTCCGATGTGTCAATGATTCGAGGATCTGCTCAAGAAAGCTCTTAGTGTCTTACATTTCAGGTAGACACAACCAAGCTCTCTTTTCAAAGTGTTTTTCGATCTCTTCATCATTGAAAATTCACTTAGCAATAGTAGTTTTCCCTAAACCACCCACACCCACTATGGGAATAGCACACAGTACAACTTCCTCTCTCATGTTCAACATCTTCTCCTTAATTTCAGCAACATTATTATCTCTACCAACAACATCCAAAGAACCTACTAAGAAATCTGTTTCTCGAATCATCGGTACTATTTGCTGAGAAGGAACTATGAGTGATTGGAGACCTAGGTCTTTGGATAACTGATTGATATCCCTCAACCCTTCATTTATATTCTTAATTTTTTGAGATATTTTGCTTATAAAAGAAGATTGAGAAATGAAACTACTGACCTTCCTCATTGGACTGTTTTGAACTTGTTCTTGTAGAGATTCATATAGGAATTTATCAAGAACATTCTAAGCATCTTCACAAAATCTCTCAAGCATCAT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox