PRGWK00002584 (RDC0002NLR0071)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0071
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:CC, Domain:NBS
Location Start 50736600
Location End 50737735
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGTTTACACAAAATGTATCCTTGATCCAAGCTTTTATTCATGATGCTAAAAGACGACAAGTTGACAATCAGGCTGTGAAACTATGGCTCAAGATGCTTGAGAGAGTTGCTGAAAATGCTGAAAATGTGTTTGACGAATTCAGGTATGAATCTATCAAAAGACAAGTGAAGATCAGAAACAAACCAATTGAAAAGGTCATTGATTTCATTTCTCATAAAACTTTTAAGAGCAAAATGTCTAGAAAAATCAACAACATCAATGAAAAGTTGAGGGCTATCAATAAGTTAGCCAAAGACTTCGGTCTCCAATCACTCATGGTTCCTCCTCGGCAAATACTACCGATTCGAGAAACAGATTTCCTAGTAGTTTCTTCGGAGGTTGTTGGTAGAGACATCGATGTTTAAGTGATAAAGAAAAAGATGTTGAACAACAGAGAGGATGTTGTTTTGTGCACCATTCCCATAGTTGGTATGGGGCTTTAGGCAAAACAACAATGGTGTAGAGAATTTTCAGTGATGAACATATCTTAAAACACTTTGAAAAGAGAGTTTGGTTGTGTCTACCTGAAATGCCAGAAATTAAGAGCTTTCTTGAACTAATCCTCGACAAAGAGGAAAGTTGAGGTCCAAAGCAGAGATATAATAGTCAAGATGCTACAAGATGAATTGGCAGGAAGAAAGTATTTGATTATCCTAGATGATTTGTGGCGTGCTGACTCTACATTATGGGGTTAGTTTGCGGACACCTTGCGAGGAATAAATACATCCCGAGGAAACTTCATTCTTGTACTACTCGTATGGAACAAGTGGCGTCCACAATAGCTGCAGTAGGTCCTCATAGGTTGGAAAAATTATCAAAAGATCATTGTTGGTCCAATTTTAAATAAAGAGCATTTGTTGATGTGGAAGTTCCAGAGAAAATACAGATCATGGAGAACAGGTTTGTGGAAATGTGTCAAGGTTTACCATTGGTTGCGAGTGTGTTGGGAGACCTCTTACGCAACAAAGAGAAATATGAATGGCAGACAATTCTTGATGGAAACCCCCTTGTTGCAGGTGAAGATAATACTGGTCAACGAACCGGAATGAGATGCGTTGACCGGTATGTTGACCGGTACCGGGATGAACCGGATTGA

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox