PRGWK00002607 (RDC0002NLR0094)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0094
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS, Domain:LRR
Location Start 52380107
Location End 52383979
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

TTACATGCGTTCCCAATCGATGTATATGGAGGGGATATGAGCAATATTTGGCCAGTATTCCCCCTTTCCAAATTCTAGTAGTGGTTTGAGCAATGGACATTTGGAAATTGCTAGTTCAGAGAGGGAAGACGGCATCCCTTTTACTGGAAGTGATTGGAGATTAGGGCAATCATAGATGGTCAGGCTAGAGAGGGAGGAGGGCAGTGCTGATTCTGAAAGTGATTGGAGATTAGGGCAATTGGAGATGTCCAGGTGAGAGAGGGAGGAGGGCAGTGCTGATTCTGAAAGTGATTGGAGATTAGGGCAATCATCTATGATCAGGTGAGAGAGGGAGGAGGGCAGTGCTGATTCTGAAAGTGATTGGAGATTAGGGAAATTGAGGATGGTCAGGTGAGAGAGGGAGGAGGGCAGTGCTAATGCAGCAAGTGATTGGAGATTACGGATTTGTAGAGTTTGAAGCGAAGTGAGGTGAGAAAAGGAGGAAAGCTGGCCTTGTGACTGAATCTGAGATAAATTACCATCAAAACATAGATATTGAAGAGAGGTGAGGCTTTTGAGATGTTGGCTGCTTAATGTTATCAGATTGCATATGGTAAGACTCTGAATAGAGGAAGGCAACTCCCAATGTTCAATATCTTCGTCACTCCCATCATGATGGATCCATAACTCTGTGAGTCTCTGTAAATGCCACTCCTTTCGGCCATTCACCAATTTCTTGCAATAACTGATATAGAGTTTTTGTAAATTGAAGGGCAATTCTCCTTCTATTTCTGGACAATCAGACAGACGCAGTTCCTTGAGAGATGGAAGGAGTTCCTGCATACGTTCTGGAAGACACTTGAGCTTCTTACACTCCGAAATAATCAGAGACGTCATCTGGGCCGCTCCTCCACATGCCACCGATAGTTTTTCAACATTCTCACAATTCTCAATAGTGAGAGTTTCAGTGGCAGTAGGAATCAAAATCCTAGTAACGTTCTGGCAATCCGTAATAATCAATTTACGTGCTGTTGGGAGAAACTCAGGTGATATATCTTCTACACAACCACAATCATTCACACTCAAATACTCCACAAACATCTCACCAACTGGAGCCTCCAATTTCAATTTTGGGCAACGAGATATCTGTATTGTCTTCAAGGTAGTTGGCAGTATGCTAAAAGGAAAGGAGGTAACAGACTTACAATCACGTATATCTAATTCCACAATCTGCTTCATTCCCTCAAGTTGGGATCTTAACAGTTGAGCATCATCAAAAACAACTGGACAACCAACAACCCCAAACCTTTTTAAACTTGAAAGTTGGATCGGTGTCTCCAAACTGAGATCAGGACAATTTTCTATTAAAAGTTTCTCAAGTGTAGGGAACTCTCCAATTCCTAGTGCGTGCCATTGCTTCCACTCCGCCATATCTTCAAATTCAAGCTCCACAAGAGAATTAAAAGGCTTTTCGGAGGACAAACTACCATAGAATTCTTCCGTCACCACTCTTATCCCATGCATCCCTTTAACGGAAAGGAATTTCAAACAAGGGAGTTGTCCTAGTGCTGGCAAGGAATAACAGTTCTTGCAGTTTCTAAGAGACAAATTCACCAGCTTAACAAACGAAGGATCAGCTACCCAATTGGGAAAGTTTGTCCCTCTATATCCACTGATTTTGACTTCTTTAATGTTTTTATGTGGGCGTAGCTCATCAAGTATGTCTCTTTCTGTTTGTGAATTGTCGGCAATACTACTTTCACTCCACTCCAATAATAATTGCTCAACATGATTCTTCTCCCTCATCTTTGCCTTCACAGCTTCCCTTCTATCAACCACATTTTCCAACTTCACAACTGATAGAGATCCATATAAGTTTTGTGCTTCACCCAAATCTTCCATTCTCCAACCACCTACAAAAAACTTGGCTCCCACCAACACTTGGAGGCTTTTCAACCTGCTCAGATGTAGTGGCATCTTCAAGCGCCGAGTGTTGCTTATGTCAAGATGACGCAAGTTAATCAACTTCTCCATCTGCAGCGGTAGCTCCTCAAGAGTACCACAAGATGACAGGAGAAGTGTCTCTAAGTTATACAACACACAAATGGAATCTGGCAACCTTTTAATCTCTGTCCGAGAAATATCTAAAAATCTGAGGAGCTTTAATTTGATAAACAAGTCATTTGGCAACTCCTTCATCCCATAACCTGACAATGATAATGCCCTTAAGGATCTTAGTGTAGGCAGTATGTTATGCAACACCCTCTTGGTTAGAGGGTGATAACAATAATTGACACTAATACATGTCGGAAGCAATGTCCTCAGCTGCTCCAATTTGTAGAGGGGTGCCAATTTCTCAAACTCACCATTAACTCCTATTGAATAAGATAAGTGCCGACATTGTTCCAACATATGAGATCCTTGGCTCTCTTCCAACCTGATACAAAGTTTTGAAGATGCAAGTTGGGCTAAATCGTTGACAAGGTCATGCATTAGGAATAATTCCTTTATGTTTCCTTCAGAAGGATTTGGGACCCTTTCAAATAATGATCTTGAACTCAACTCGAAAAAGAATTGGTTGCCTAAATCTTGAATTATTTCATCTTCCACAGGTACAAGACCATTGGCAATCCAGAGATGAATAACTTGTTCTTTCCTAAATGGATAATCTTTAGGAAATATTGCACAAAAAGAAAAGCATCGCTTTAAATGTGCGGGAAGATCATTGTAGCTCAACATTAACGCTGGTAATATGTCATTGTCTTGCAGCTCCCATATTTCACTTCTCAGAATACATTTCCACTCTTCAACCTCTGATTTGGAGCGTAACATGCCAGCGAGCGTCTTCAGAGCTAAGGGCAGTCCTTTGCACTTAGCTGCAATTTGTCTTCCAACCTCTTCAAGTTCCGGATGTCCCATAGGATCCATGTTTTCAAATGCATGTCTTTGAAATAAAGACCAAGAGGCTTCGGTAGACAAATTGCCCATGCTAATTTGCTCATTTCCCATCATCAAGGCAACACTGTCTTTGCGTGTTGTCACAATGATCTTACTTCCTATATCTCCTTGTACAAAAATATTTCTCAAGTCATCCCACTCGTTGTAATTGTCATTCCACACGTCATCAAGGACAACAAGAAACCTTTTTCCATTCAGCTTTTCCTTCAATTTGACTTGTAGCTGATTAAGATTGTGATCAACCTTCAAGTCAAATGATCCAATTTCTTGAAGTAAACCTTTTGTTATTGTGAAAGCATCATATACCTCAGAAACACAAAACCAAGCTTTCAAAACAAAATGTTTCTGCACTCTCTCATCATTGTAAGCGGCTTTAGCAAGTGTTGTCTTACCCAAGCCGCCCATTCCGACAATAGGAACTACAGCCAGATTTTTTCCCTTTGTATCCATAGAAAACAAACGGCCAATCAAATTCTCTATTTCATTCTGCCTTCCAAAGACACCAGAATCATCAAGCAAAGAAGTTGAAGGTGTTCTAGTATCTTGTTTGGTCGAAATAAAATGCTCCTTTAAGCCAAGGCGACCAATTTGCTTTTCCAACACCTCCAATGTTTCAATGGTTTCTTCCAACTTTTCCTTTATGTTAAGAAAGAAATCATCACTCAAGCACAGGTTAAGGTCACTTACTTGTTGATTGCTTGTTTCTGCAAGATTTTGATGCTGGCCTTCCACCTTAAGTCTCAAAGCTTCATAATTGAATTCTTCTATCAAGTTTTCAGCGCCTTCCACAGCACTCTGAAGCTTATTAAACCATTGGCTCACATGTCGATTTGATGCTTGCTTATTCTCTGCATCACTTAGCACAATCTGAAGACCAAGCAAAATGTCCTCCAGCTTCTTTAAGAGCTTAACATGATCCTGATGCTTCCGAAACAT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox