PRGWK00002630 (Solyc01g102840)

From PRG Wiki
Jump to: navigation, search


Solyc01g102840
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:TIR, Domain:NBS
Location Start 83291991
Location End 83297153
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

AAACAAAAACTCGTCATTTTTTTCCCTTCACGCGGGCCTTTCCATTGACTTGAGTCCTCAAAGTTCTCAGTTTTCCTATTTTCCTTGTCTAGTTTTCATTGTCAAAATCTCAATTGGATCATTATCCTCTTTGTCTTTGCATCAACTCTCAGTTGTGTCATCGTTTTCTTGGACTTTTTTCAATGGCAACCCCACAAAACCGTTATTCTTTCCATGTTTTCTTGAGTTTTAGAGGCGAAGACACCCGGAAAAACTTTACTGATCATCTCTACACAGCTCTCATCAACGCTGGAATTCGAACTTTTCGAGATGATGACGAAATCCGCAGGGGAGAAAACATAGAATCTGAACTGCAAAAGGGTATTCGAGAATCCAAGATTTCACTAATTGTCTTCTCTAAAGACTACGCTTCTTCAAGATGGTGTCTTGATGAGCTTGTCAACATTCTTGATCGAAGAAAGAAAGAGGGTCATACTGTCTTGCCTGTTTTTTACACTGTCAGCCCTGAGGATGTTCAGAACCAAAGTGGAAGTTTTGCTGAAGCTTTTGTGAATCATGAAAAGAGAGGAAATGCAGAGAGTGGAGAGAAAAGAAAGGAATGGATGGAGAAGATGGAGAAATGGAGATTAGCTCTGAAGGAAGTTGCTGAATTGGAAGGAATGTGCTTAGCCAAAGAAGTAGACGGGTCAGTTTCCTAAATTATCCAAACCCTTGATATTTTTTCTTCTTTTTCGGTATTTGCAGTTTATCCCCCCTTCATCAATTAGTCTTGAGAGCTTTGGTAGTTCTAATTGTTTCTGGTTAAAGAAATAGTTGTGGATTAATAATTGCTTTAATCTTTACTTGAAGGGAAACTTGGCTGATGATATTAGGAAAGTACTATAGATAATAATTTAAAACTATGTTTTGTTCTGGATTAAGTAGTCAAGCGATTGATTTCTCTATTTAAATCTGGAAGTTCTCTTTTGAGGATCAACGTTATTCCAACTTAGCCAACAAAGATTCGCCCCAAACAAGAAAACCTACTCATCAGTTGGAAAGTTCTGATGTAAATTTGCCATTCACTCAGCACTAGTTGTCCTGTATTTTAGGTGGCTTTTGCAATGACATAGTGCCAGTTTGCTAATTCATAAGTAAACAAGTTGTAAACTTAATTTTCTGAGAATAGCTTATAGTATCTATGCATCTGACTATCATAAATGTCCAAGTGACTAATGTGGCCCTCAAAATCATCTATTGTAAAGGTTATTTCAGGAAAAGATACACTGGAAATGCTAAATGAGCAAAATTTAAAAGCTGGATTGACGAAATTTCTGCCAAGGATGAAAAATTAACTGTGAACAGTCCAAACTTAAAAGGAGATTTAATATGTTAAAGACCCTGAATAGTACGTTGAGCTCTAACCAAGTTCGAGCAAAAAAGTTTAACAAAGTTGGCATAAATCTAATTTGAAAGACTAATCAGATGAAAGACACAAAGTTCAAAGCTAAAGATGACGAATTGCTACCTCAGGTTGGATTCTAGTCAAGTGTGACACTCACGTGTAAGTATGCCAAATGGCAAGTACTATGCTGCATAAGTCGCGATTGAAACTCACGGGGTTCCCCTAAAAGATAGAGATTCCTAGCTTTCATGTATATTCCTTTTCTCTGAATGTAATGTATTGTTGGTTATCTCCACTCTAGAGACAAACGAGGATGGTCTCCGGGCTTCTTTTGTGCTATGAAATGTGTCACGTGTGGATCCTATTAGAGAAGCCTCATAACTGATCCCTTTTACAGTATTTTCTGCCTGAAAGACTCAAACCACTAGAAATAGAGGGTCTTTTCCCTATTAGATCTATGCTGATTTTGAAAGGAGTCCACATAGACAACATACTGACTTGTACTTATCCATTACAATCACCTATATCCTTAGGAAACACATTTTAATGCCCAATATTTCTGACGACTCTTCAATTAGATTTCTGTGTCCTCTTTTCCATGGATGTGTGCTGCCTTCTACCTTGGGGGTATGGAGGCACCCTAGTTAAACTCTTGCTGTGTGTGGATGTGTGTGTGCATACATAAACATGTCCCTTAACTTGGTGTCGACGAACAATTATGCCCTCCATCTTTGTATGTGCACAAGTAGCCACTTAAACTATTATAAAATTGGACAATTAGACATGAGTGTCCTACATGGCATAATACACCTAGGATGCCATGTAGAATACAAAATTGCCATGTAGGGTCCCATGTAGGAAGAATGTGTCCATTTGCTTAATTTTATATAAATTTGAGTGCCCACTTGCGCACACCCAAAGTTAAAGGTCATAGTTGTGAATTGACGCCAAGTTAAGGGTCATGTTTATGTATAATGCCTTCTTTTTTCTTTTCCGTTCTTTCCTTCCTTTTCCTGCTTATCATATGCCAGAAGTTAGTAAGACCTCTCTCTGACTAGTTGAGGCAAAAAACTTGAACAATACAACTAGGGACACTTGGATTTAAACCTTGCTCTCAAATTATTCTGATTAAGATAGATGGGAGCAATAATTTCTTGCTTTCCACGGAATCTTCCTTCATGTCTGTGCATGCTCTTGACTTGTATGTGCTTTTAGCTTTTCCAATCAGCAGTTCTTCAAGCCATTGTTTCCTCAATTATTTGTTATCAGTGTCAAAATGATCTATTTAAAGAGTGAAGGATATAGAGGGTACCAAATAGCTGAATAGACAAATCAAAAGGTACAAAAGAACGAAATGTTGTCATGATACACTCCGTTCTCCTAATGTGGATGCACTTTGTATCAGTATCTTTTGGAAATTTTTGTATGATATAGCGTCAGTTATGATGAGGCTAAAGTTGTCTTAATCCTTTTCCACTTTTTCTAACCGGAAATGGTTCACTGTAATATTTCATGGTTCTCTATTTATTATACTACTTTATTTTGCTGTCCATTTCCCTCTTTGTTGCTCCTCAATATTGTCAAATTCTTCACAGCACACAAGTAAAAGTAAATATCACTCGTTTTTTCTCCTGTAGTACCAGTAAGCCACATATATTTCATCTCTGTTGCTTTTCTGGAAAATGTAAAATTCATTGATTTAGCATTAAGAGATTGCTTCAAAGTATACTTTCACATGTTCTCTTAACTAGGCACCTAACCAGGTTATTTTGTTTATTGATGATTAATATGACAGATCATCTTGGTGTGTTATATTTGCTCTAAAAGTATTACCATATCAGTGAACTCTTTTTATTTATTGTCCAGTACTTGGCAAGTTGCAGTGCTTTACTGAATTTTCATCTTGTTTTGTCTCTGACATTTACACTGCACCTCAGGCATGAGGCAAAATTCATCCAAAAGATCATTAAGGAGATACTCAAAAGATTGAATCGCACAGTACTTAGTGTACCTTCATACACAGTTGGACTAGAGGCTCGAGTGAAGGACATTAACTCATGGTTACAGGATGAATCCAGTGAAGTTGGCATTGGGATGATCTGTGGACTTGGTGGCGTTGGAAAGACTACTGTTGCTAAAGTAGCTTACAACTCTAATTATGATAGATTTGATGGGAGTTGCTTTCTTGCAAATGTCAGAGAAATCTCTGAGAAACATCCAAATGGTCAGGTTTATTTGCAAAAACAAATTTTCGAAAGTATTTTGAAAGGCAGAAAGGAAAAAATATACAATGCTGATGAAGGAATTGTCAAAATGAAAGATGCTATTGGCAACAAAAAGGTTTTTATTGTATTTGATGATGTGGATCAGCTGGATGTCTTAGATTCACTTATTGGAACAAGGGATTGGTTTTATCCGGGGAGTAAAATTCTCATTACGACAAGGTGTGAGAAACTATTGAAGTCCTATGAGAGGCACATGCTATTCAAGATAAAGGAACTTGGAGATGACGAGTCTCTAAAGCTCTTCAGTTGGTATGCTTTTGCACAAGACCACCCATTAGAAGAGTTCAAGATGCTTTCAACAGAAGCAATACAGCATTGCTGTGGGCTTCCGTTAGCTCTTTATGATTTGGGTTCATTTCTTTCAGGGAGAGGTACGGATATATGGAGGAGTAAATTGCAGAAATTGGAAGCAATCCCTCATAGCAGAGTTCAAAAGAATCTTGAGATAAGCTACAAGTCTCTAGATGATCATGACCGGAGGTTGTTCCTCCTTATTTCTTCATTATTTGTTGGGAAGGACAAAGATTATGTTATCAAATTTTTAGAGAATGGTGATTTGCACCCAACAGTTGGAATTCAGAACCTCATTGACAGATCCCTCATCAGCATTGATGACGAAAATAAGGTGATGATGCCTCCACTTATTCAGGACATGGGGAAAGAAATTATTCGTCGAGAATCACAAGATGATCCCGAGAGATTGTTGTGCAAATGGTTGAACCAATGCGGTCTGTCACATGACTTGACAGAAAACAGTGTAAGAATTTTGACTTTTGCATTCATTTTAAGCTTGTCTTGGTAGATTCTCAAAGTGTTGTTGTTTCTCACAAAATCTTTCTGCAACAGGGAACTGATGCAGATGGAGTAGACCTCCAAGGCACGCATCTGCCAGAAGATGGTCTTGTCCCAGCACTTGGTCCTAATGCTGCAAAAAGACCATATTATCAAGATTTTCCAGAAATAGCTGTTCTGCCATACCTAGGTAATTCGTTGAAAAGGCGTTTTGTTGGACTTCTTTCGACATTCCCCTTATCTGGTGGCCTCAAAAGATTCTTCCCATGATGAGAAAAGTACTTGTGAAGACGCCTTCTTTCTTTCGGAAAAACCAACATTTTACTACTTAATCTTGTGGAGCTAGAAGATATACATGAGTGTTGTGTGAGGCGGCGGGGCTTCAATAAGGATCATTATCTGATAATATCTGAGCATTTCTTTTGCTTGACATACTGTCTTAGTTGCACAAATTTGTTAGTTGCAGATGTATATTCTGTCCTGTTCTTTTTCATCAGCTTCAGGTGGGCAATGGTGTAAATTATGTTTTATTAACTCATTGTACAGTCATAGGATCATTTCTTGCTAGCTGCATAGTTTACTTCAGCAAACAGTTCACTGGAAGGAACTAAAAATGTAATCTTTAACCATTCCTTTTTAGTCTCTCAAAAAATATCTGAAGTTTTACCATTCCTTTTATATTTCTAATTAAATTTTATTGAC

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox