PRGWK00002632 (Solyc01g103610)

From PRG Wiki
Jump to: navigation, search


Solyc01g103610
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS, Domain:LRR
Location Start 83940119
Location End 83942752
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

TTCCACCGTGTTTTTTTAACCAATTCATAATAATCTGCAAAGACAAAGAAAAATCCCTCCTTTTCAACAGTTACTAGCGACGAAATCAACTATTTCTTCGCAGAAAAACTAATCATTTCAAGGCAGCAGAATATATGATAGTGTAAGAAGGGGGGAGCCTAATGTAATCTGAGTAATTAATCTTGAGAAACATGGCTATACATTTGAGAAGCCACAAATAACTATAAAAATAGCACTTCAAAAATTTGAGTAATTTTTACACAAACGGTGAAACTTACCACCATTGAATTAATTTCCTCTTTCAATTTCTCTTGCTGATTTCAAGAGATTCAAGGAGAAATATAACTCAATTGACTCCAAGGTGCATATATCCGCAAACTCCAGAGGGATTCTATCCAGGTGACACATCAGTTGTAACACTACGCAATGAAGATTTGGGAAGTTATCACTGTTAGCCTCCCACCTTTTCATGCATACGTTATCAAGTAGCAGGAACTTTAGCTGCTTGAACTGAACATCATCATTTAGTTTCCACACGTCACCATAGAATGAATTGTTCCTGAGTTTGAGCACTTCGAGATTGCGCACCTTCGCAATAGTTGCTAAATCTTCCCACGGAAGGTGACGATCAAACATGGTCAACCTCTTAAGAGATGTTGGGAAACAACAACAATTCGCCAGGCGTGACGACAGTGAACACATCCTAAAACATAAGTAAAGGGATTCAAGTTTATTTAAGCAGACAAGACTGAGTAAGCTCCAGGATGTTTTTATCTCATTGTATTCGATATCTCTTCTGAAATCATCGATCCTCAATTTCTTTAGATTCGCAAGGCAAGATAGTACCACCTTTGTACAACTAGCAATACAGAGATTTGAAACCTCCTGTAGATGATGCAGATCAACATCAGATGAGTTATTGCCTTGAGGATTGGGTAAATGAATGTTATGCATAACACGGAGATGCCTCAACTGCTTAAGATTCCAGAATTCTCTGGGCAAAGTTAGAACCTTTAATATTTTACGGGTATAAAATATAAAGGTTTGAAGGTTGTGCATATATCCAAGGAATTCCGTGAACTCACTGTCACTAGTAACTTCAAGGTATCTCAGGATAGCTGAATCTAATGTCATGTGATGGCGAAAGATAAAGGAAGACTTAGGAATGACCAATACTCTCAAAGCTTTGAATTCCGAAGTTTTTCCTGTTGGTTCCTTGAAGAGGTACAAGGAAAGTACAACTTGTGAGGACTTCATAAACTTTTCCAAGGAAATGGAGGTATGAACACTAAAGTTCGGCGCACTCTGTTCATTTGCTGCTGAAAAATTAGGAACTTCATTATTTGTAATCATATTCAAAAGCTCTTCCTTTTCAGCATCTCTCACACTCAAATCCCGTAACAGTTCATGCATACTGCAACTTTTGATCCGACCATCTACCTTCTTCCTCGTAACCATTATCAAATTTCTACTGACAAGATCCTCCAAGCATTCCTCAGCCACTTCTTCAGGACTTCTCAACTGTCACTCTTTAGAAATCCCTCAGCAACCCATCTGATCAATGTCCAAGCATCAATCTCATTACCCTCGGGAAATGTTCCGATATGGAGGAAGCAAGGGTTTAGGTGAATAGGCAAGTAGTGGTAACCCATAGCAAGTAATCCTATGCGTCCTTCCGGATCACTTGTAACAACTCTACTAACATTTTTAGCTACTATTTTCCCAAGTTTCTTTCGTCATGGGAACTTTCGAGATGCCATGCAACCACCAATATAGATAACGGCAGTCCTTCACATTTTCCAACTATTGCCCTCCCTATTTCCTCCAATTCTGCAGGACAACTTTGTTCTACACCAAATAACTTCTTGTGAAGTAGCTTCCAACTATCATATAAACTCAATGGCATCATTTTGTAAGCATGAACTTCGGGGTTAACATGCATAGCTACACATCCATTCCTTGAAGTCAAAATAATTCGACTACCATTTCTGTCCTCTGGAAGAACTCTTGAAATCACATCCCATATCTCTGTGCTCCAGACATATCTCTGAAAATGGCCTGACTGTTGAAGTAGCAGCAATGGAGGAACAAAAATGCCTGATAAAGACTTGAAGAAACTCCCCTGTTTCCCCTGTACAAGGTTGAAAAGAGAGACAGAAACAGAAGAGAAGATACCTCGGAGTGTATAGTTAAGACATGAGAAAACTGCAGGTTACGGACAAATTGCAACCACAGTTTCCATGTCAAGTGCATTGGTTCATGGTTGGTACAGACACCAATATTGTCCAATTTGTCGAACAATTTTCCTGAAACAATCCTGCTAAGCATATGTGCGGAAAGAGATTGGATTCTTGAGCATATAATCGAATATTTCAGTCCAATCAAACTCATTTGCTGCTCCTCTGCCACCTGCTGTCCAGAAATGCACACTCATTTTGAAATTTCTAGCATTCTTCTTCTTTGACTAAGCACGAAATTTTGATCATTGGATTAAGCTCGCTAGATATAATGTACCTAGTGGATCATAACTAAAGGTAGCTCTACCTGCACCTTCACATACACTCTCAACTCAATTGAGTAATTTTGTGCATCAGACATAGCCGTCACTTCTCCGGGAGACCATCCATCCACCAT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox