PRGWK00002634 (Solyc01g113620)

From PRG Wiki
Jump to: navigation, search


Solyc01g113620
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:TIR, Domain:NBS, Domain:LRR
Location Start 82315767
Location End 82320596
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGGCTACTGAATTCAAGTCTCAAGTGTTCTTGAGTTTCAAGGCCAAAGATACCGGCATTACTTTTGCAGATCATCTCTATGAAGCTCTGGCTGGAGCAGGTTTTGTAACATTAAGAGGTGGCGATGGAGACGAGGGAGGAGAAGAAACCAAATTGAAATTACAAAAGGGTGTTGAAGAAGAATCAGGGATTTCAATTATAATCCTTTCAAATGATTATGTGTCTTCAAGTTTGTGTCTTGATGAGTTGGTAATGATCTTGAATTGTAGTAAAAGAAGATCAGTTCTGCCCATATTTTACCATGTGGATCCTTCTGATGTTAGGAAACAGAAGGGGAGAATTGGAGAAGAATTTGATAGGCATGAAGAAGCTAAGGTTAAAAAATGGAAGGAAGCACTCAAACAAGTTGCAGACTTGGGAGGAATGGTCTTACAAAACCAAGCTGATGGGTGAGTTCATTAACTTTAAATGCACTTTGAGAAATGTTTCATATGAGTTTATTTTAAGCAAAAGTATCTACTTTATTAGAGTTGGAGCAAATTGTATTTGATTGGTAGCAATCCTTATTAGAAAGAGAGAGAGGGACTTAACATTGCTAAATATAATTTGCCTTCATTTGTCCTGCATTTATGAACTTAACATGTCTTTATCTCAAGTCTTTCTAATGACAATTTCTGTACACTCTATTAGGAGACTGTGTTCCCATGTTGCATGATTAAGTTCTCGATTCCACGAACTCACAGAATAACTTTGTGTTGGTTACTTTTCCATTTCGTTAAAACATTTCAGACATGAGTCCAAATTCATACAGAAGATCCTTAAAGTGGTTGAGAATAAACTGAGCAGGCCAGTTCTGTATATTTGCCCTCATCTGATTGGAATAGAAAGGCGTGTTGAAAACATCAACTCATGGCTAGAGGATGGATCTACTGATGTTGACACTCTTGTTATTTGTGGCATTGGTGGAATAGGCAAGACAACAATGGCAAAGTATGTGTATAATTTGAACTATAGTAAGTTTGATGGTAGCAGTTTTTTGTCCAACATTAGAGAAAATTCAACACACCATAAAGGTTTAGTTACTCTTCAAAGACAATTTCTTTCTGATATTTGCAAGAGAAAGAAGAAACCTATGTTTTCAGTGGACGAGGGAATGACTGAGATGAGAGATGCTGTAAGTTGTAAAAGAATCCTTCTTGTTCTTGATGATGTTGATAGCCGCGATCAATTGGATGCTCTACTGGCAATGAAGGACTTGTTATACCCTGGAAGTAAAGTCATAGTGACAACTAGGAACAAGAGATTGCTTAGGCCTTTTGATGTGCATAAGCTTTACGAGTTTGAAACTTTGAATAGAGATGAATCAGTTGAGCTCTTAAGTTGGCATGCATTTGGTCAAGATTGTCCTATTAAAGGTTTTGAGGTATGTTCAGAACAAGTAGCAATCGATTGTGGAGGACTTCCATTAGCACTTGAAGTTCTTGGTGCTACTTTGGCAGGAAGAAACATAGATATTTGGAGAAGCACAATACAGAAATTAGAAGCAATTCCGAATCATCAAATTCTCAAAAAATTAGCAGTAAGTTATGAATCTCTGGAGGATGATCATGATAAAAATTTGTTTCTCCACCTAGCTTGCTTTTTCATTGGGAAGGACAGAGATCTAGTAATAGCTATTCTCAATAGGTGCAACTTTTACACTGTAATTGGAATAGAAAATCTAATTGACAGAAATTTTGTAAAAATTAGTGAGTCTAACAGGTTGATTATGCATCAAATGATTCGAGATATGGGAAGAGACATTGTTCGCCAAGAATCACCAATGGAGCCTGGGAAACGCTCTAGACTATGGCGCTCCAAGGATTCCTATAATGTCTTAATCCAGAACCTTGTAAGGAATTCCGTCTCATATGGCTGATACCTTATCCTTTGTTGAGATTAGCGTTATTCATCTTGTTTCAGTAATTAACATAGTTCTCGTTAAGTTAAAATGAAATGGGTTGAAGATGAGTACCTTTGCCTTTACTCATCGTTTTCTGTCTTCTATCTGAACAGGCCACTCAAACAATTCAGGGCATTATCCTTAACATGGATATGCTCAAAGACAATGACATAGTTAGCTCAAGTTTTTCTGCCATTGATTTCAAGAAACACAAAACAAAGAACTTTCTCAACTATCATAATCCTCAGAGAGGTCAATTCAAACAGAAAACGTCTGGTTTTTCCCCATGGCATTTATCAGATGTCAAAGAAGTTACAAATCAACTGGTTCTGGAAACTGTTGTGTTTGAAAAAATGCAAAAGTTAAGACTACTCCAGTTTGATCACGTTGAGCTTCAAGGATCTTTTGATGTTTTTCCTAAGAGATTAAGATGGTTACGCTGGTCAGAGCTGCAACTAGAATGCATGCCAATTGATTTTCCTCTGGAGAGCCTTGTAGTGATTGAATTACAGCATAGCAGATTGAGGAAAATCTGGCATGAAGTCAAGGTACGCTAATAATGTGATTCATTCTTTAAGGTGTAGCAGAAACATAGTTTTGTCTGATTCTGTGTTCATTTCTATCTTTTGTCATTCAGTTCCTTAAATATCTGAAGATTTTCGATCTCAGTCATTCCTACGAGCTTCTAAGAACACCTGATTTCTCTGGACTGCCCAACCTTGAGAAATTGATCCTTCGATATTGTACAAGCTTGATTGAGCTTCATGAGACCATCGGATGTCTCGAATCACTTCTTCTGTTGAACCTCAACAATTGCAAAAATCTGCAGAGACTTCCAGATAGCATTTGCATGCTAAAATGTCTGGTCACACTAAATATCTCTGGTTGCTCAAGTCTTGAATATGTACCGATGGATCTAGATAAAGTAGATTCACTGAGAGAGCTCTATGCTGATGAAATTGCAGTTCATCAAATGGTTTCTACTGCAGAAGAGGTTCAACCGTGGTACGGATTCCTGCGGTCCTGGATGTGCAAGGGGACAATATGTCCTAAAGTTTCACACATTAGTTTACCCAATTCTTTGGTTACTTTGAGTCTTGCTGGATGTAATCTATCCGACAATACTTTTCCAGTTGCTTTCAATAGCCTCTCCTTATTGCGAAACTTAGATTTGAGCCATAACAATATTTGCAGTCTGCCAAAGGGCATAAGTTATCTTACTAGACTTCAAAAGCTACAAGTGGAAGGCTGTGAAAAGCTCAAATCTCTCATAGGGCTTCCCAATATAGAACATCTCAATGTTACTAACTGCAGCTTGTTAGAGAAAATATCATATCAATCTAAATCATCTAGTCTGAAGAATTTGCTGGTCTCAAATTGTGTTGAATTGGTGGAAATAGATGGAAATTTCAAGTTAGAGCCCTTGAGAAATACTGAGGCAGGGATGCTTTGCAAGCTAGGCTTGTTGAACTTGGCTCCTATGGACAATGTCATGATCAATCTTACATCTAACATACTGAGCTACTACCGAATACACGGTAAAGGGTGGACTCCAAGAAGGAAGACAAAGAAAGTTGTTCTTCAGGTATGTCCTGCTTATTATACCTGCAAATATCTACTTGCAATAGAATTGAAGACAGGAGCATATAAAAGTTCTATGAGTTACTTTTTTTGCAGGGACTGTACCAACCAGGCATCTTTAGCACTTTTCTTACTGGTGAAAGAGTTCCTCCTTGGTTTAGCTCAAAGTTCTCAAAAGAATCAAGTGCATCCTTCAAAGTACCTACTTGCAATTCCAGAATAGAGGGATTGAGTTTTTGCATTGTGTACAAGCGTTCCACGATTGGGCTTTCACCGAGCATTCTCGGTCCTTCACGGCTAACACCACCTCCAAGAATTTCTCATCTTGCCATGCGCAAAGCTCAAGGAAGACCACTTCGTTATAGGCTGGTGGAAAATAAACCATATGAATCAACTTTCGATTGCCCATGCATTACAGTTAATAACTTAACTCGAAGTTTGAAATGGTCTTACCAGCCCTTGTTCTATGGAGTTCCAGAAGGGAGAGAAGGAATGATGTGGTTAAGCCATTGGAAACTAGAGAATCAGTTGAGCAGTGAAGATGTTATAGAGGTCACAGTTACCGCAGGAGATGGTATCACAGTTATGGAATTTGGGATCAAAATTGTGCATGTTGAAGAGACAAAAGTGCTAGGGAAACCAGGCTGTGAAGAGACAGATATTGTCAATCCATTTTGGGATGTTAATTTGGTACATGCCACCACTTCAAAGGATACTTTTTCTGTCCGTCTTCCTCCTACTTATCGTTCCTTACGTGCTGCTCATGAGCTATTTATGGAGAAGGCACTTAAAAGAAATATGTCAGACTATAACTAAGAAATTTATTACCTTCCATTATACACACTAAAATGCATATCAAAACAAGAATAATGTCAGAAAACAGTGAGAACTTAAACAGTTCACACTTATATTGCATGACAGTAACCTTTTTAAATCAGGTACCCAGATGATCTTAACACTTGAGGAATAAATCTACGTGAAAAAATAAGGAAGGGAATCATGATAAGACCATCCTGATAATAGTAAATAAGAGGAGTGTTTGATACACGCGAAATTGAAAGACAGACAAAAATCTAACCTAGGAGCATACAGGCAACTATAAGAGGTGACCAAAAACCGTCAAAATAACAAGACCAAGATTAGAAAAAATTGTACATTTATTCATCATCTTGAACTTTGGACTTCTTTTTCTTCTTTTTAATTTCAACAGCAGCTTGGAGTTCCTCTCCATTGTCCTCTTTGTTCTTCTTTTTCTTCTTCTTCTTTGCTGTTCCATCCTCATGCACGCCATTACCATTACCAACAGT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox