PRGWK00002638 (Solyc02g032230)

From PRG Wiki
Jump to: navigation, search


Solyc02g032230
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:LRR
Location Start 18728246
Location End 18729138
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

CTACTCTAACATGAAATTCATTTCAAAATTTGTTTCTCCTTGTACAATAGGATGTTCTGGCATTCTCATAGATAATAAGTTCAAACCCTGAATATCATGATTAGGCACATCAAATCTGATTGAGGAAGATCCCGTAGAATTGTAGCTTAGCCAGTATGGAAGCTCACTTCCATGAAAAGAAGTGCTGAATATACCAAATTCAGAGAGGCCCTGCATATTAAACGCAAATATGGAGACGAAATGAGATTATGTTTTATCCAACTACATCTTGGTATCTTACTTCATATATAAGTGTGACAGAAGCAAGAAACTCGTATTTCTTTACCAGACATGAAATATAAATGGGACTTGTAAGAGATGGAGCAAACCTGTATAGAACCTTTCCATCTTGTTAGAGTCAGACTGTTGTAGAGATCCACTTTCATGTCACTCAAGTTCTGTAATCCCAGAACACTGATTAAATCAGCATGAAATGAAGAAATACATATTAACTGGGACATTTCCTGAACCTCAATAAGTTTGCTGCAAGATAATCCAAGAAAATTCATTGTTGTCAATAAGTTTGGTAAATTGTGCATCCGTTGGAGTGACCTGCATTGCCAAGTACTCAAGATTTTCACACTAGCTGGGATCTCTGGAAGATATTCAAGTTGTTCGCAATTTTCTAAATCAAGTTTCCTGAGATTGGTAAGCCTCTTGATGCTTTCTGGTAGACTGTGAATTGGATTCTCACTTAAAAACAAGTTCCGCAGCATGGAGAAATCACCAAGCTCCTCTGGAATCAAATCACTAGATAGACCACATCCAGTAAGGCTCAAGGTTACTAATGTATGAGATACCGTAGTTAACAGGATTCCAGGAGATTTTCTTGGGCTTAAGACTGAAGAGCACAT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox