PRGWK00002639 (Solyc02g032240)

From PRG Wiki
Jump to: navigation, search


Solyc02g032240
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS
Location Start 18748158
Location End 18749543
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

TTAACAGCAGGCAATATCAGGGAATAAGCTTTTGTCATGATCATCTTGTATAAAGGCAAACCTAATCTGAAATTTCTTGGATACTTGACTATTAGGAATTAACCCTAGTTTCCTCAGTGTACTTTCCCATACATCTAGACTTTTACCAGAGAGAGAAGAACCAAAAACTTGTAAAGCTAGAGGACATCCAATACAGTATTCTATAATCATTGTGAAGAACTTGGTGTAATGCTCGACTGGATGGCCTTGTCCGAATGCATGCCAACTAAATAGTTCAACATATTCATCTTTGTTCAGTTTTTGAACATCATCAATCAATTCAATTTCACAAGCCCTCAGCAACTCTATGTGCCTAGTTGTCACTATAATTTTACTACCTGAGCAAAAGCAATCTCGCATTACAACGATAGCAGATAACTGGTCCACTTCATCAATATCATCCAGCACAACAAGAACCCTCTTACCATAAACAACACTTTTTATCTGATTCGTTCCATCTTCAACACTGTGAATGTCAATTTCCTCCCATCGGTAGACTCGGAAAAATCTCTAACATTGTAGAGGAAGCTGCTTCTTTCAAACTTTCAAAGTTAGAGTTAAATGCATATTTGGCGATTGTTGTCTTTCCTATACCACCCATTCCACAAATTCCCCAAATACCAACATCGTCTGTTTTATGTTGCAACCACAAGCAAATATCGTTAAGCAAAAAATGTATACCAATTAGGTAAGGAGAAACACTGAGGATTGAACGGTTTACTTTATTTTCAGTAACTTTGACAAGTTTCTCTATAAATCTCAACTCATCAGTCCTATAATAAAGATCAAAGTGGAACAAACAAAAACATAAATGTTGGTTAGTCATATGTGTTACGATTGACAAACAGAGTAACTATGCTTGATATTTATGAACTTCTACGCCTGATATTGATTTGGCTACTCTGACAATGAGTATTTACTCAAGCTTAGGTTTTGTATGTCTGTTTTCACTTAAGTGAGTAATGTTTTCAGTTATTGCACTATTTTGTTAAAGCAAGCATTGTGTTTTCATTGTTTGATGTTAGGCATGGCAAGCCTAATAATGGAAGTTCAATCGAAAGCCATCTACAAGGAAAAGTCAGCCATCTAAAGTTTTAACAAGAGATCATAGTTTTATTCAAAAGCAAAAGTCAAAGTCTCACTCCCGGTAAACTTCAACTTTTTGTTTGTTTCATCCAGAAGACGTATCCATACTTTCTATATGCTCGAATCTTATATGTTGTTCGTTTTTTGGCATCAACATGAACTAGGTAGATGAGAAAAATAGAAAAAATAAAGAGACGATAAAGGAATTTACTCTTGAGCTGAATTCTGTAAAACTATGTCACTACTACGTTGATCAGCCAT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox