PRGWK00002699 (Solyc05g006620)

From PRG Wiki
Jump to: navigation, search


Solyc05g006620
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:TIR, Domain:NBS, Domain:LRR
Location Start 1267542
Location End 1277499
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

TAACAAGAGTTAACTTCTATTTATGTCAAAAAACAACAGTTTTTTTAAATTCTCACTGCATTATTGTTCACTGCATAACTATCTGTACGTTGTTGTTCACAGTATAAACAAACACACGACGTTCATATTCAACCGCGGTCATGAGGTTTAAAATCTCTTGAAGAAAAGGTACTTCAGAGCACAAAAAATCTCCTTAACAAAACTAAGAAAGTTACCTGTTCCATCCCCTTCTCCGTCTTCTTGAGCTGAGTTCGAGTTGAAGATATTGCTCTCTCTGTTAGAGGCTCCGTAAAACCTGGTTAATCTTTCTGATACAGATTGTTGGGTTTCATCCAATGATTCTTCATTACCTTCATAGTCATCATCATTTTCTTGTACTAAATGTATTCCACATTTCTTCAGTTCAATACCTGTAACGGGTAAGTTGCCCAAGCCGACATGTATAGAATCTCCATCTTCAAGAATAGATACTAATGGATGATAATCTTGATGCCTGCATAAATAAACTTGATCCTCGGACGTTGTTGGGACTCCTGCCAAGTACATGCCAGTAGTAAATACTGGTCTATTTGCTCTAATGATTTTCGCAAAGATATTAGGGACTACAGGCAGTTCATCCCGTAAATCATCTGGTTCAGCACAGTTCACAGAAACAACTATGGCAATAATCACTGCTTTGATATCATTGTTTTCGTGCTTTGAGAAATGCACCTCATTCGGAGTAAACCAACTTGGAATTTCATTGCCTGGAATACTCAAATTATCCAAGTTCTTCACAGCAAGCTGAGTGTGAAAACAGTTGTCATTAAGGTAACTGTTTTGGCAAGAAATTGAATGAAAGAAATGGCGTGTTTCGTATGACAGGAAAAAAAAATCCGGAAAACATTTTTACGAAAGCATATAGGAGAAAATAGTACCTTATCAAGTTTGTTTCTAACAATAGAGGCACAAGAGACGTTGCATCCAACCATATGTAACATTTTTAAGGATCTCAAGCATTCGACACCTTGGACGTCGCCCAAACTCATGCAATTTGCGAGGTTTAGTTCGTGCAAGAACACTAATTCTGAGATATCATGTATGCTCTCTAGTGCCCCACAATTTGCGGCATTTATCTCGAGCAAACTTGAAGGAAGAGGAGGAAGAGCTTTCAGCTGTTTGCAGTGGGGAATTAAGAGCTTTTTCAAGAAATGTAGTCCTTTCAGACTAGACGGCAAATGGGAAAAATCATTGTGACCGAGATCGATGAACTCCAAAGATGACAGTTTCTCAAAATCATCAGGTATTTTCCCAACTATTCGCCATGCACGTGCATTAAGTTCTTCTAACAAGGATAACTTTGAGAAAGATGAAGGAAGCACAATAGGTACGGTTTCCCTTTCTGCATAGGTAGCTGTTTCTGTGATTTCAGTACTTTGTGGTACCTGCACAAGTGTAATTTTTTGAAAATGTGGATTCAACATATAATATTTATACTAATTTTCACCACAGTATACCTGAAGGAAAGGCTTCTTTCCCATCCTCAGAATCATTAAGCTCGATAGCATCCCAAAAGTTTGAGGTAATACTGTTACTGCAGTCTCCTCCATTAACAAGTGTACTAAGTTCTTTAGTTCCCCAATAGAATCTGGCAGTTTGTGCAGACGCTTACATTTGGTCAATCTCAATATGACGAGATTCTGCAACTCTCCAACTGATTCTGGCAGCTCCGTGATAGCATCATTTCGAGTAATAGTCATTGTTCTAAGAGCTAATAATTCTCCAATGGAATCGGGTAGTGATCCAAGGTGCTCACAGTTCCTTATCTCGAGAGTCTTCAGTGATTTAAGGGCTCCAATATGTGGAAGACAACGGATCGGAACCTTATCTATTTGAAGCTCAACCAAAGAAGCCAATCCTTTAACTGAAACAGGCAATGCAGTCAACTGCTGACAGTTTCCAAGTGATAAGGACCTAAGATAATATAGACAACCGATAGATTCTGGTATAATTTCTATTGCACTGCCATAAAGCCAGAGATTTGCTAAAGATTTGAGGTTGCCAACAGAATGGGGAAGAGCAGCAAGTGACTTGCACCTAATTAAGCTTAGTGTATGAAGGTTCTTCAAATTTTTAATAGAATCGGGTATTTCTTCCACGGCAGAGCCATTAAGAGAGAGTTCCTTCAAAGCACTTAAATTTCCTACTACCCCAGGAAGTTGTTTCAATGAGTAGCAGTGGTTTAAGCTTAACCTTTCAAGTTTTGTTAAGCGAAATATACTTGAGGGCAAATTCACTATAGCAGTCTCATCTAATAGAAGTTCTTGTAAAGACTTCATCTTGCCTATATCTTCAGGTATCTGTTTCAACTTCGTGCAACCCGAGAGTATCAGCTTTTTAAGATTTTTCAGCCCAGAGACCTCACCTGGAAATTCAACAAGGTTGCGGCAATCTCTTAGATTTAAATGACGTAAAGTTGTCAAATTCCCAACTGTTTTGTGAATCCTTTGCAAGTTGCTGCAACGCTCAGCTATCAACTTTTCCAACATCTTATGCTTTGATAAATCGGGAATAGCTGATATTTTATGACAATCAGAGATATTCATAACTTTCAACTTGTTGGCCACCTGCACAGTATAGAAAAAAATGGTGAAAGAATATATATTTGAGCTTGAAAAGAAATGAGACCATATCAGGACTTTCATCAACTAAAGGATGCAATATAGGTATTCTAATTGTATAGAACCAAAATTCTGTGATTCTGATTTCGCTTTGGGAGCTCTATAATCCAATGATGCTTCATTATTATAACAATAAATGATCATAGCTGAGAAGAGAATTTTTAGCTTCTTCTTGCCAGATTATCACCCATCATTAGCAAGTTCTTGACATTAATTTATTATATATGTGGAAAATGTAAAAGCATACCTTTTTACGACTCCAGGTCCATTCCCCGCTTCCAATCCTCTCTATTTGGCTCTCTGAGAGATCAAGTATGGCAAGTTCACTTGGGTAATAATTAGAATAATAACTTGAAAGAGTGCATCTTTTCCACTGGAGCCATTTCAGTGAAGAAGGTAACTTCCCCAAATTTCCCTCTAGTTTCACATTATCAAGTTGGAGTAGCCGCAGATTAACTATTCCATCAAATACTTCAGTATTCAATACTAACTCATTGGTTTCTTTTGCATCATTTTGAAATTGACCTTTGTATAACTCTTTAATGTAAGCTAACGCAGAACTGAAACTGGGAACTTCTTGAAATCGCTCTCTAGTAATTGCTTTTGCGGTTTTGATCTTTGATGAGTGCCTCTGGTGCTGATCCAGGATGATCCCTTGGATATGTTGTGTTCCCTGTTGTTTTTATAACACATCAAATTTTTCTATCACAATATAAGTTTAGCAGCAAAATAATCAGAAGAAAGCAGCTGGAAGTTCTTGTAGAACATAACAAAAGGACGTTAACTTCTTTATGGTCACCTAATATGACTACAGGTAACTGTTCGTAAAAAGAAGGATCTGTTTAGGGAAAACAAGACAGGTTAGAAAATTCTGACAATATAAGAATTTACGGGCGTAGTGTATAAGTTAAATTCATAAAGAAAGTCATACCTTTCTTCCTTGTAGCACACTCAAAACATCAGCAACATCCCAGAGCCTGCTGCGCTTTCCAGGATCGGAAAAGCCTTCTTGCCTAACAATCTGTCTTCCCATATCTCTTATCTGGTCATGCATCCACAAGTCCCCACCATCAATCACCTTAATCAATGATCTAGTGGTCAATGTGTCAAAAGCAATCCTGGCTCTAAAACCACATCCTTCCATCACATCAATTACATTTTCGACTTTCTTATCTAGTTGATCAAGAAATAAACATGCAACATCCAGGAATATACACTTCTCTTCATCATCAAGACCATCGTAACTTATTTTCAAGACGTCTTGAAGACGGGGTGAGCGAATTTGTTTTAGCTTTCCTAGAGCATCTACCCATTCCTCCTCGCTTCTTTTATCAAACAAGAAAGAACCAAAAACTTCGAGAGCCAATGGTAGCTTTCCAGTAATTGAGACAATTTGCTTAGATAATTTCAGAAAAGTTGGGGATGGGTCTGGTCTTCTAAATGCATGGTAACTGAATAGTTTTAGTGAGTCAGTATCACCCAATTCTCTCACCTCAAACGTCTCGTCAACGATGTCTTCTATCAGAACTTCTTTGTTTCTAGTACTAATGACAACCCTGCTTCCTTCAAAAAACCAACTTTTCCCCCCAATTAGTGCCTTTAGTATGTTAACATCGTCAACATCATCTAAGACCAGCAGGATGCGCTTTTCTCGAAGCATTCGCCTGAACTTTTCTCTTCCCTCAATGGCATTAGCAGGGGAGAAGGAGAACGCGTTGCTAGGGAAGAGACCCTGTATGATTTTCTTCTGAAGGGACATAATGCCTTGTTGAGTAGCTATTTCCTTTACATTCAAGATAAAAGTCCTGTGTGTAAAATCAGAAGCAAGTTTATTGTAAAGAGCCTTAGAAAGAGTTGTTTTACCAACTCCTCCTATTCCATGCAACCCCAAGATTTTGACACCGTTGCTCTTGACATCCAACTGTCTTATGAGTTCTTCCAGACTGTAATCAATTCCAACAACAAACGGAGCTACAACCATTGGGGAATTGCTTAATTCATCCAAAACTCTTTGCACCACCAACTGAATCAACTGTGACTCGTCACTGTAGAATGGAAGCAAATTAATTAAGATCAAGTTAACTTAGGAGGTCTTGTATCTGTATTTCCTAAAAATCATATTCGAGGAAGTTCAGAGGTAAACGGAAATGATAATGTCACGACACAAAACTAAGGGGTCGTGAAGGCATTCAGCAGCATCTCCTTACCCAATGGACTCTTCCTTATCCCTATATCAGTCACCATTGATGTGCTCTTTACGGCACCATCACATCAACAAATATGGATTATATCCAACAGATAATAAAAGAAGGAATTGCCAACAGTCTAACAAACATTAAAACACAAAATATTGCCAACATATCGATTATTAAAACATGTGCTTTAATCATCAAAACAAAGTCAAATACCCTCAGGTATCCAAAACATGATCATGAGGTTCATCGTTGTAAAAACATATGCATAAACATCATTTTACATGTTGAAACTCGCTCCCACAAGCACAAGCCCACAATGTAAATCATAAATATCAATTTTCATTATGAAAATTGATCAAACACTTGAAATGTATTCTTTTAAAAGTACTTCTTTTGTTTAGAAGGTATGTCTCCACTTAACTCGATTGAACTTGCGCATTCATTCAACGACATCCCACAATAGTCAATCTACTCATAAAGTAGCCTAATTTTGTCATTAGAGGCTCAACATGATTAAGTTGACAGCTAAAACTCAGCTTATTAGGCCTACAAATAACCATACAATTGAAACACTAAAATTTATCTCATCTCTTCCAAGTTTTGCCCATTGTTTATCACTCATTTATATTATCTATATACCTATCCATCATCTAACACAACTAGATATATGAGGTTCATCCGCAAATCAATCAAAATCACCCAAACACCTTGAGATGAGCCCATGGTTCTAAGTTCTAACCTCAAACCAATAGGTCAATTCCAACCTTAATTCATCTATATCCATAACCAATTACTCCCTCCGTTTCAATTTAACTGTCCTACCTTGTTTCTATATTGAGTAAGTTTGTCATTTTCAATATCCCACCTTACAAGTTTAAGACAACAAAATTCTAAAGACTAACATACATAAGATTCAAAAATACTCGTATCTTTAGCTATTCAACTTTGTATCGAATTAAAGTAAGATACTTAAATTGCGACGAAGGAAGTATGATATATAAACAATATAAAATACTCAAGTGAAGAACATACCTCATCTTCTTGAAATTTGGTTTTCTTACTTGCTAGGTCAAACTTTAGATTTTAGACAAAATGGTTGTACTATGAGGTTCAGATTCTTGTTACTGATTATATAATAAGCCAAATAATTTACCTTTAAAAAAAGTTGTGCAAACAAAAATAAAAATAAAGTTAGGCCGGCTATGTGTCACTTTAAACATTTATTCTACAACCATTTTTCAACCACCTTAATCTATTTGTTTTCATTTCCACTCAATCCATGTCTCTTTCTAGACATGAGGTTTACGGTACGTCAAAAGTATTTTTAAAATTTTTTCATCTTTGATTTATATAAATAAAATGGTGACACCTAAATCAACAATGGAGCTCATGGTGCAGGCCATTGCTGTTAAAAAAAAGTTTTAAAATTATGGCTATCTAAATTAGAACTTTGACCTCTTACAACTAAAATTTTAGACGACACCAAGTGGTACAAATCACACTGACAAATATTGGGAAAAATTAATAAAATCACACTAGTTTGAAATAACTATATTCTATTTTATTAATTGATATCTCATACCAGATATCAAGTCAAATACATCTAGGAAGATGTTTTTTTTGCTGTCAGATACATTTAAATAGGGAGAAAGACGAGCGAGAACAAGAGAGAGTCGAGGGAATTTATTTTTTTTGTATCTCAATTACATGTGAATCACACTAATATATGTATTTCGAATACTAGATACACGAGCGAGATGGAAGAGAGGCGAGCGAGATTTAGACACATGCGAATATACTTGTATACAATGTATCTAGAACAAATTACACCTAATTTTGATTTCATATATCTTGAAATAGATGTATCTGGGTGCACCTAAATTTGGTAAATACGTAATATTATAAAATAATATGTATCAAAATAATTAACTCCTACACTAATAAAATTTCGATAAGTTACCGTAAATACTAAGTAATTAAGCTTTCTAATTAGTGGATAAGGACATATTTGGATAAATCTTACAATTATAGAGGTCCATTTAGGAAGACTTAATCGAAGAGGGCCAAAATTAAATTTGTTAGATTTTAAAGAGTAAGCCCAAGCCCATAAGTATTATTGATTCATTTCATGTATCGATCTTCGTTACATGGAATTAGAATCTAGCCTACTGATAATAATGTATTTTTAGCATATTATAAGTTGTTGTTTTTTTTGTTTTTTTTATGATGTTCAAAGCCTGTATTTCGTACACAATAGGATTCATTCAGAAGTGACGCTCTGAACATAATTCTCTCCATACCCAAAGCTTCGTATATAAGTTTGATTAATTCTCAAACAACAGCATATACATGGGTAGACATATAGCCATTAAACTTCATGTACACTACTAAATTATGGAATTATCCATGTGTTTCGGAATTTCTTTTATTGTTACTCTATATTTGACGATAACATAATTTTAAAAATATTATCATTTTTCCTATAAAGAAACCACATATATACATTTTTGTTAATTGAAGATTATTGATGCTCATTCAAATATATTACGAGGATCAAATTTTAAAAGTTCATCAATGACTAAGAAGTCAAAAATGCAATTAGCTAGCCGTAAAATTAATTAAATTAGAGAGAGCAACCAATAAAAAAAGGAGATAATTAAGCTCTAATAATATAATTAATGTACACTAGCAAGTCAAAGACTCTTTTAATTTGTATGTGTTGAATTAGGGAATAAAATAATGGAACCACATAATTGGTATTTAGCACAACTTTTCAAGAATAAGTACTAATTTATTGAGTTAATTATTCTGGTTTACACAATATATTATTCGTTAAGTACGTACGTAGACTTGTTGCATGCATGGGGACAGTGCATTTCCAAGTAATTAGCTAAATACGGAATACCATTACATTATATTATTACTCTCTTCGTCTCAAATTATCGATCATACTTTTCAAAATTAATTATCTCAAATTATTTATAATTTTATAAATATAAGATAAAATTCTTTATTCTTTTTTTATTTACCCTTAGCAGTAATTATTCTTAAAAACTACAAATATCTTCATTATGAGAAGATTACACATAAATAAGAGAAAAGCACGACCTATAATTTAAGACAGAAAATAATACTAATAGTATCATGATTGTGTTAGATTCATGATTGAGTTTAAATATGGTGGATGATAAAATTCCAATATTTAAATTATATAAAAAGTATATAATATCAAATCTATTTTTCACCGAGTTTTAAATTATAAGCTATTTATTCTTGAAAATTACTCGACTATCAAATAAAATTATTGCAATTGCCGGGTCACTCTCATTAATTAATGTTAAGAGGAAAACAAAATTTATGATACTGATAGATTGATACATCCACTAGTTTTTCAATTAGGCTAACAAGGTGTCTTTCACTAAAAAATCTACCTAAATTGTGATATAACTTGTTTGATCGAATTTTAAAAATATATTTATTTTTTTAAAAATTAATATTTTTATTTTATTTATTTATGATTAATCATGAAAAAAAATTAAACTTCCAAAATAGTTTTGCTATCATTCAAAAGCACTTTTAACTTTTTCCTAAAACTTAAAGCTAAATACTTCATACTCTTTAAATAAGCATTTTCTAAAAAAAATGAAATAATTTATAATAAAGAAAAGAAAATAAGTTTCAATAATAACATTTCATGTTGATTTTTCTTCGCCCATTAACACACTTTATCATCACTCGGCCTCCACAACTCCTATCTCCATAATCTCACACTTTTAGTCCCACCTTTTATTATGTTTATTTAGATTATGTGTAAATAATAATATTTTTTATTTACATATCGAACGTAAAAAATAAGTAAAAATTTCTCTTGCTTTTTTTTTTAAAAAAAATAATTTGACAGATTTTAGCTCACCGATAAAAGTGAGTAATTTTATATTAAAGAAAGATATTCTTTAGGTGAAGGTTTAGACTCTTTAATTAATTCAGATGTTGAATTATTACGCCTTACTCCTAGAGAGGACATATCGAGAGAATAATTAGTAGATTGATGAAAATCATAGCACCATAAATTGAATTTTTCTTTAACAAAAAGCAAGATAGATCTTCATACCTCAATATTTATATATATTTTTTAATTATAATTTATGATATATTCATGGACAAAAATTTCACACCCGAAACTATACAAGGAGACCAAATAAGTCCACCATCATCTACCCTATGTAGGAGCTCAACAGCTCCACGTCACACGAATTTAGCTTCTTAAAGCTCAAATTCGAAACCTCTAACTATCAAAATTAGCCTTAATAATCACATTCTAGGGTTTCTATCAATTAGATCTATTATTTAATTTGATTCCAATTTGTTAAACAGAATAAAAAAAATAAGAAGATTTAGAGAGAGAATTATAGTTACCCATTATCGTAAACCCAACCAGAGACTCCTCCAACTCTTTCCATGGCGTTTCTCCACCTCGCCATTTTTTCCGGTGAAAACTTCCTTTCCAAATCCCTAAATCCATCGAGAAATGGCCCTAACTGCCTCCGTACATCCGACGGATTAACTCCGTAGAACAGAGGCAGAACGAGTTTACCCAGCTCATAGATCGTTGCTAATTCCTCGAGGCACCATCTCGAGGAAGCATAATTTGGGGAAATTATAGCAATTACAGCAGCAGAATCGTTAATTGCTTCTATTAGACCTGTTGAGATCTCATCGCCCTGAGTTAATCCCTCGGAATCTCGAAAAACTCGAATGCCTTTCGAGTATAAGGCGTTGTATAAGCTGTTTGTGATGTTGTTTCGAGTATCTTCGCCTCTGAAACTCAGGAAAATATCGTAATACAGCCGGAGTGATGAGAGTGAAGCAGTAATTGCCTGCTGCTCGAATTCCTCCATTAGAGAGAAAATTGGATACGATCGGTCTACTCTGAGGGATCAATTAAAGGATGCAACTTCAGAGAGGTAGCTGTGTATTATGTACTGTCAAAATGCTTTTGGTGTGCAGTACGTAAGGTATATGTAAAAGGAGAGAGTCATAAGAGGAATTTCCTTTTCTTTTCTTTTTCTTATTTTGATATTTTTTCGTGAGTTTTTGAAATCA

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox