PRGWK00002718 (Solyc05g018010)

From PRG Wiki
Jump to: navigation, search


Solyc05g018010
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS, Domain:LRR
Location Start 19455020
Location End 19456317
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGTTGTTCTGTACCATAGTAGGTATGGGGTTTTTAGGGAAGACAACATTGGATAAAATAATTTTTAATGATGAACAGATTGAGAAACACTTTGAAAAAAAAGTTTGGTTGTGTCTACCTGAAATGTTGGTAATGAAGATCTTTCTTGAACTAGTCCTGGAATCATTGACATACAAGAAACTTGAGGTCCAGAGCAAAGATATTATAGTCAAGAAAATTTGAGATGAACTGACAGGAAAAAAATATTTGCTTGTCGTGGATGATTTGTGGCATGTTGACCCAACGTTGTGGCATTACTTTGTGGTTACCTTGCGAGGAATAAATACATCTCGAGAAAACTTCATTCTTGTGACTACCTGTATGGAACTGGTGACGTCAGCAATAGTAGTAGGACCTTATATGTTGGAAAAATTAACAGAACATCATTGCTGGTCAATTTTCAAACAAAAAGCATTCGTTGATGGGGAAGTTCCAGAGGAAATAATGAGTATGGAGAAAGGATTGTTGAAATGTGTCAAGGTATACCTTTGGCTGCAACTGTGTTAGGAGGTCTCCTCCGCAACAAGAAAAAACATGAATGGCAGGCAATCTTGATGGGAATACCCTTGTTTCACTTGATAAAGATGATAATGGAGAAAATAGCTTTAAAAAAATCCTTAAACTCAGCTTTAATTATCTTCAATCTCCACACCTGATTTTTTTTTGCTTACTTTGCAAAGTTTCCAAATGAGCTTGAAAAGGACCAACTTATTTAACTCTTGATGGCAGAAGGATATCTTTGTCCATTTCAAGATGTCGTTCTAATGTTAGATGTTGGGAATATGTTTTTTCAACTTTTGTTGCAATTTTCTTTGCTGCATGATGTGAAGCTAGATGAGCATAATAATATAACACATTGTAAGATGTATGATCTTGTGCATGATTTGGCTTGAGATATTTTTAAATCTAAATTATTTGATCAAAAGAGCATCAAAGGAGAAAATTTGTCTCAAGTGCGATAACTTTGATGGAACTCACCAAGTGATCAAATAGATAAGATAAATGAGTTAGGACATTTGTACACATTATTCTGGAGATGAAATTCTCTATCTGAAGATATGTTATTTAGTTTTGAGTTCGTGAGAATTTTCAATTTGTCCAAGTCAGGTATGTGGGAGTTGACAGCTTCATTTGGCAAGCTAATACATTTGAGATATCTTGATCTCTCTGACACTAATATCAAATCTTTGCGTGACTCCATATGCAAGCTCTACAATTTGCAAACATTAAGAGTTAATAACAATTATTATCTTGAGTAA

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox