PRGWK00003188 (RDC0003NLR0349)

From PRG Wiki
Jump to: navigation, search


RDC0003NLR0349
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:LRR
Location Start 109
Location End 798
Organism Species:Solanum pimpinellifolium
Approved true



CDS Sequence

ATGGTAATCACCGGGTATAGAGGGGCAAAATTTTCAAATTGGCTTGCTGATCCTTTGTTTCTTAAGCTAGTGAAATTGTCTCTTAGCGACTGCAAGGACTGTGATTCTTTGCCAGCACTAGGACAACTCCCTTGTTTGAAAATCCTTTTAATTAGAGGGATGCATGGAATAAGAGAGTTGACAGAAGAATTCTATGGCATTTCATCCTCTAAGCCTTTTAACTCTCTTGAGAAGCTTGAATTTGAAAATATGGCGGAGTGGGAGCAATGGCACATACGAGGAAGCGGGGAGTTCCCTAAACTTGAGAAGCTTTCAATTGAAAATTGTCCGGAATTGACCGGGAAGTTGCCTGAAAATCTTTGTTCTCTGACTGAATTGAAAATTTCAGGATGTCCTCAACTCAATTTGGATAGATCCCAACTTGAGGGAATGAAGCAGATTGTTGAATTATCTATACGTGATTGTAACTCTGTTACCTCCTTACCTTTTAGCATACTTCCCAGTTCCTTGAAGAGAATATACATAGGTAATTGTGAGAAATTGAAATTGGAGGAGGCAGTTGGTTGTAGTGACATGATTCTGGAGGAATTGGAACTGCAAGGATTTGATTGTATAGATGATATATCACCTGAGTTTCTCCCAAGAGCACGTAAATTGAGTGTACAGAGTTGCCCCAACCTTACTAGGTTT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox