PRGWK00003190 (RDC0003NLR0351)

From PRG Wiki
Jump to: navigation, search


RDC0003NLR0351
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS
Location Start 3395
Location End 4334
Organism Species:Solanum pimpinellifolium
Approved true



CDS Sequence

ATGCCAGGACTTGGAAAGACCACACTGTCAAGAAAAGTTTACCTTGATTTTCATTTTTACAAGAGAATGTGGGTTTATATTAGGACATCGAAGAAACCAAAGGATCTTGTTGTTAAGATTGTAAAAGAAGTCGCGCCAAGCAATAGTGAAGAACTAATTAATGACAAGGATGAGGAGCAATTAGCTCATATAATACATGGTTTTCTCATTGTCTTGGATGATGTGTGGGACTCACAAGTTGTAGATTTTGTCGAGAAAGCTTTCTCAAACAACAAATCCCAGCCCCGAGGGAACAGAATCATGTTGACAACTCGCCAACAACGTGTAGCTGAAGCTGTCAGCGCTCATCCTCACAATCTGGAAAATATGTCAAAAGGGGATAGTTTTTAAGTTGTTGGAACAAAGATCTTTTGGCAAAACAAGGGAGTGTCCTATTAAGTTAAGAGGATATGGAAATGAGATTGTAGATAAATGTTGTGGCGTACCACTTGCTATAGTGGTGATTGCAGGAGCTTTGAGAGGTTGTGAATGGAAACTAGTAAAGAATAATGTGGGAAAGCACCTTATAAACAAAGATGACAGTAAAAGTTGCTTGAAATTTGTTAAAACGAGTTACAATCATTTGGCGCAACAGAGAAAGGCAGCCTTGTTGTATTTTGCAGTATTTCCTCAAGGCTTTGATATTCCTGCTTGGAAACGTATTCGCTTATGAGTTGCTGAGGGGCTAATAAAGTCCGATCTTCAAGGCAGTGAAATCGAGGAGGTTGCAAAGACTTACTTGAGCGACTTCACCGGGAGGAATTTAGTGATGGTGATGCAAAAGAGATCTAACGGTCAAATCAAAACATATCGTCTCCATGACATGTTGCATGAGTTCTGCATTAATGAAGCTCAAAGGATAAGTCTCTTTCAACAAGTATATCTCCAACATGGTGTTTGA

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox