PRGWK00003191 (RDC0003NLR0352)

From PRG Wiki
Jump to: navigation, search


RDC0003NLR0352
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS
Location Start 36687
Location End 37208
Organism Species:Solanum pimpinellifolium
Approved true



CDS Sequence

ATGGTCACTATCTTCAAAGAATATAATGAGAGACAAATGCTTCTTGAAGTTGTCTCTACCATTACAAGAAGCAATCAAGAAATGAGAGATGATCAACTAACGAAGATCGTTTAAAGAGGTCTGGAGGGTGAGAGATTTGTAATTGTAAAAGATGATATATGAAGTACTGAGTCATGGGACCAAATTCAAAGAATATTTCCAAATAATTACAATAGAAGACAATTTATGTTAAACATTGGGCTCTTGTATGGTGCTAATTATGTTAGTTGTCTTGATTTTTTACCTCATGGAAAGCCTTTATAAGTCTTGATGGTAGTTTGAACTTCACCAAAAAAAATTATCAAAAAAGATTTGTTTCCTCCTCTACGTGTACAACAAGGAAAGCATATTGTACTACAATGTCAAGGATTACCTCTTTCGATTATTGTTGTTGCAAGACTTCTTGGTCAAATGGACCCAACACATGCTAATTGGATGAATGTTGAGGAAACTGAACTGATTCTTGGTATTGTATCTGAATAG

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox