PRGWK00003192 (RDC0003NLR0353)

From PRG Wiki
Jump to: navigation, search


RDC0003NLR0353
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS, Domain:LRR
Location Start 297
Location End 2813
Organism Species:Solanum pimpinellifolium
Approved true



CDS Sequence

ATGTTTTTTTTTATAACAATAACTAATTTATCGAGCGTCAATTCCAAGGTTGTAGAAAAAAGAATCAGGAATGTAATATACAAAGCAGAAGATAGAATTGATTCAAGTCTAAGAAACATCCCTCTAGCAGATCACGAGGACAAGCGGAAAAAGGCTTGTAGATCCTTTTATGAAGAATTGTTGAAAGTTGAAGAAAAAGTTTATTTTCTCAACAAAGAGGTGATGGTGATCAATGTTAACAAGCATGGAAGAAAATCTGTAGAATTAGCAACAACTTCCTCCTCACCAGACAAAAGTACAACTGAGGAAAATACTATTGTTGGGATGGAGGACGACTTCAACACCATACTTGATCGCCTCATTTCACAAACAAATGAGTTAACTGTCATACCAATTTTTGGTATGGGCGGTATAGGTAAGACAACTCTTGCCAGGAAACTTTATGATGATTATTCTATTCGTTGTCGATTTGATAAACACGCATGGGTCACTATCTCTGAAGAATACAATGAGAGACAAATGCTTCTTAAAATTATCTCTTCGATTACTGGAAACGATCGAGAAATGAGTAATGATCAACTAATGGAGACTGTGTATAGAGGTCTTAAGGGTAGGAGATTTCTAATTGTCATAGATGATATTTGGAGTGCCAAGGCATGGGACCAAATGCAAAGAATATTTCCAAATGATGACAATAGAAGCCGAATTCTGTTAACCACTCGCCTTAAGTATGTTGCTGATTATGTCAGTTGTCCTGATTTTCCGCCTCATAGTAAGTCTTTTCTAAGTCTAGAAGATAGTTGGTGTCTATTCACCGAAAAATTATTCAAAAAACATGCATGTCCTCCACCGTTAAAAGAAACAGGGAAACACATTGTAAAACAATGTCGAGGATTACCTCTCTCGGTCGTTGTTGTTGCTGGACTTCTTGGGAAAATGGACCCAACGCATGACAATTGGAAGAGGGTTGAGGAAAATCTGAACTCATTCTTTGGTACGGTATCTGAACGGTGCCAATCAATTCTTTCTTTCAGCTACAGTTACTTGCCCCAATATTTGAGGTCTTGTTTTCTGTATGTTGGAGGCTTTCCAGAAGACAAGGAGATTAACGTTTCCAAGTTAATCAGGTTATGGATTGCTGAGCAATTCGTCAAGGCAAGAAGCAATAAAAGGTTAGAAGTTGTGGCAGAGGGGTATCTCGAAGAGTTGATTGATAGAAGTCTAATTTTGGCTGGTGAACAAAGGGCTAATGGAAGGATGAGAACATGCAAAATTCACGATCTTCTTCGCCAACTATGCCTAAAAGAAGCTCATACTGAAAATGTTGTGCATTTCATGAATGAGAATGCTCCCATGGCCTTAGAAGTCATACATGATCAACGGAGAGTGATCAGTCCATCAAAACTTCAACATCCGCAAGTTTATCCAACAAGTCCTAGCAGTGGTATTACAAGTATAATCCGCACCTTTATTACAACAAAAGATAATTATTTCCGATGGCATAGCATTAGTATTACAAGTTCCACTGTTTCACAGTTCAAGTTGCTTAAGGTGTTGGACGTATTATCAGTCCGGAAAGATTTCGGTTGTGTAATACCTCAGCTAGTACATTTGAGATATGTTGCTGCAAATATTGAGAAAGCTCTTTCACTAGCCAAATTGAGAAATCTAGAGACCATAATTCTTGTAAGTCTTGAACCGGCAAGGCTGAAGCACTCACTGGATATCTGGAGAATGACAGAGATAAGACATTTGGATATTAGTTATCCACTATACATATGTAATCCTCTTCTAGTAGAAAATCATATGACATTATATATATCTGATCCTCTTGAATTAGAACAGCCTTTGTTTCTCAATAACTTACAAACACTTCGTCTCCATAACTCTTCTTTTGTTTCTGAAATCATTAGAAGAACCCCCAATCTAAAAAAGCTAAAGATTTTAGATAGTTCTGACCATCCTTACTGGCATGATATTCTTTATTCTCTCATTCTTCTAGAGGAGCTGGAGACGCTACACATAAAGTTCGATTTCCTATTCACAGAGGAGCTGGATACTATTGACCTGATGATTTCCTCTGCATATAATTTCCCTCCTAATCTCAAGAAGTTGACATTATCATCTACTGAATTACCATGGGATGTTATGAATTTGTTGGCATATTTGCCCAAACTTGAAGTGCTCAAAGCGAATTATGCATTCAATGGAACAGATTGGAAACTAGACGAAGATGTTGTGTTTCACAAATTAAAATATCTACAAATTAAGTCCGATTGTCTGGTAAGGTGGGAAGCGGGGAGTGATAGTTTTCCATTGCTTGAGAAACTATTACTGTATGACTTGAATGAATTGGAGGAGATTCCTGAGAGTATTGGAGAAATAATGACACTAAAATTGATCCAAATACACCGTTACGGAGGGAAGAATGGCTCTGGTGTAGAGATTAGTGCAAAAAAAATTCAAGAAGAGCAAGAAAACTTGGGAAATTATGAGCTTCAAGTTCAAATTATTTAG

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox