Browse wiki

Jump to: navigation, search
Gene:PRGAV00000029
Has DNA Sequence GCAACGCAGGCATCGTTTCGCATCCTGGTGGCATATTTCGCC GCAACGCAGGCATCGTTTCGCATCCTGGTGGCATATTTCGCCTCGGGTGCGAATTGTCATATTTCATGCGGTCTACTGACCGCCCGCCGCGTTTTTGAGGTCATTTACGCGTATAGGTCCTCCGCAACCGTCCATCGCTCACACTGCCGCGCTGGCGATACCGACGCACACCAGTGAGAGCAGCCCGACGCAGGTGCCGCACTTGCAGGGCAACACCCCGCCACTGCGGGAACGTGCGCGTCGCCGCGCCGTCAGCGTACCTCCGCTGGTGTCATTGAACGACAGCGCGATGACCGGCAAGCCGGCCTTGGTGGCGTTGGACAGCGAATTCTCAGAGCAGCGCCTGGCCGAAGTGCAGGCGCGGCAGATCACCGTGCAGGCACTGCAAGGCAAGCTTGCCGCGCATCTTGCGCAGGCCGGCACGGCGCTCACGCCCGACAGCATTGCCGCACGCTTCGCCGCCGGCGCACTGGAGCCGGTGTATCTGGATACGGCTGCATTCAATGCCATGTCGCGCGGGTTGCCCGCACGCGCACGTGCGGCGGCCGGTCCCGTGCTGATCGATGCGCAGCAGGGTCGCATCGTCTTCAATCTGCAGCGCGCGTTTGCGTCTGGCGACACCTTCAGCGACGCGGCGCTGACCGCGCTGGGCAAGGCGCTGGATCTACCCGGCCACGGGCTGGCGACGCCGGACTGGCCGCAGCCCGCCGCACGCACGCCGACGCGGCGCAAGTTGGAGCACGCCCCGCGCTACCACGGTCACGAGGTGCCGGCGCGCGACGGTGGCGCTGCGTTCTTCAAGGCCAACGACCATCGCCTGCTGGAAGGAAGGCAAGCGCTGTTGCGCAATCATCGAAAAGCGCTCGTGCACGACCACTACTTCGAAGCACCCAGCACGCGTGCGTTAGGAAAGGACGTGATGGTGCATCGCGGGCTGTTCGATAACCACGCCGGCATCCCGGAAAATTCGTTGTCGTCCATCGATAATGCTTACGCGAAGGGCTATCGTAATCTGGAGCTGGACGTCGAAGTCAGTGCCGATGGAGTACCGGTGTTGATGCACGATTTCAGCGTGGGCCGCATGGCAGGCGATCCGGAGAACCGCCTGGTGTCGCAGGTTCCGTTTGCGGAGTTGCGTGAAATGCCGTTGGTGATCCGCAACCCGTCTGACGGCAACTACGTCAAAACCGACCAGACCGTCTCCGGCGTGGAGCAGATGCTGGAACACGTGATCAAAAAGCCCGAGCCGATGTCGGTGGCGCTGGATTGCAAGGAGAATACCGGCGAGGCGGTGGCGATGCTGCTGATGCGCCGGCCGGACCTGCGCAATGCTGCAGCGATCAAGGTCTATGCCAAGTACTACACCGGAGGCTTTGATCAATTTCTGTCCAATTTGTACAAGCACTACCAGATCAACCCGTTGCACTCTCAGGACGCGCCACGCCGCGCCGCGCTGGATCGCTTGCTGACCAAGATCAACGTGGTGCCGGTCTTGAGCCAGGCCATGTTGAACGACGAGCACTTGCGCGGTTCCTTTCGGAGCAATGACGACGGCGCGGAGGGCCTCGCAGACACCGCAATGCAGTGGCTGGAAAGCTGGACCAGGATGCGCCCGGTGATTGTGGAGGCAGTGGCCACCGACGACAGCGATGCGGGTAAGGCCATGGCCATGGCGCGTGGGCGGATGCGCCAGCCGGACTCGGCCTACGCAAAGGCCGCCTATTCGGTGAGCTACCGGTTTGAGGACTTTTCCGTGCCGCGCGCCAATCACGACAGGGACTACTACGTTTACCGCAACTTTGGCGAGCTGCAAAAGCTCACCAACGAGGAATTCGGCGTCAAGCGCACCACGGCCGGCGCGTTCCGCGATGACGGCGAAAGCCTGCTGACCGACCAGGCCGAGGCGGAATTGCTCGCCATCCTGGAAAACCGCACGCTGGCCCGCGGCCATACCGGCAACGAACTCGACGTGCCGCCGGAAACGCCTATCGATGTCAACCGGGACGCCGAGATCGTGAAGCAACGCACCCGCGAATTCCAGGCTGGCTTCATCCCCGCCGACCCGAACCACATCGCAGCGGTTCGCGAAGGCAAACAACGCGATCACAGAGCAGACATGGTGCATGACCCTGCAGAAACGCGTGCGGTGGATAAGCGCGCTCAAGCGTCTGGTTTGTTGACCGAAAAATACCGTGGTGCTCCTGTGACGCATTATCTCAATGAGCAGGCCAACCAGACCGAGCCGGATTGA CATTATCTCAATGAGCAGGCCAACCAGACCGAGCCGGATTGA
Has Description Xanthomonas oryzae pv. oryzicola AvrBs2 (avrBs2) gene, complete cds
Has GenBank ID 108946643  +
Has GenBank Locus DQ641035  +
Has Name AvrBs2  +
Is Gene Type Avirulence Genes +
Is from DB true  +
Is in Species Species:Xanthomonas campestris +
SameAs http://bio2rdf.org/page/geneid:108946643  +
Creation dateThis property is a special property in this wiki. 7 August 2012 14:09:57  +
Categories Avirulence Genes, manually curated  +
Last editor isThis property is a special property in this wiki. User:Cepabot +
Modification dateThis property is a special property in this wiki. 7 August 2012 14:09:57  +
hide properties that link here 
Gene:PRGDB00000030#13 + , Gene:PRGDB00000030#14 + Has AVR Gene
 

 

Enter the name of the page to start browsing from.
Personal tools
Namespaces

Variants
Views
Actions
PRGDB
META-SPECIES
Wiki
Toolbox