Browse wiki

Jump to: navigation, search
Gene:PRGAV00000030
Has DNA Sequence GAGGGTCGGCAGGGATTGGTGTAAAAAACAGCCAAAAGTGAG GAGGGTCGGCAGGGATTGGTGTAAAAAACAGCCAAAAGTGAGCTAACTCGCTGTCAGCACAGAAATTTTTCACAACCTTCTGCCGATCCTCCATGCGGGTCCGTGATCGCCTTCATGTCTGCGCCTCACCCTGGTCGTCGAGGGTTGCCAGGATCACCCGAAGTTGTGTACTGCCATGCGGCCTCGGAAGCTATGTAGGAACCACAGACCGCTAGTCTGGAGGCGACCATGTAAAGAGGTATGCCTGATGGATCCCATTCGTTCGCGCACACCAAGTCCTGCCCGCGAGCTTCTGTCCGGACCCCAACCCGATGGGGTTCAGCCGACTGCAGATCGTGGGGTGTCTCCGCCTGCCGGCGGCCCCCTGGATGGCTTGCCCGCTCGGCGGACGATGTCCCGGACCCGGCTGCCATCTCCCCCTGCCCCCTCACCTGCGTTCTCGGCGGACAGCTTCAGTGACCTGTTACGTCAGTTCGATCCGTCACTTTTTAATACATCGCTTTTTGATTCATTGCCTCCCTTCGGCGCTCACCATACAGAGGCTGCCACAGGCGAGTGGGATGAGGTGCAATCGGGTCTGCGGGCAGCCGACGCCCCCCCACCCACCATGCGCGTGGCTGTCACTGCCGCGCGGCCGCCGCGCGCCAAGCCGGCGCCGCGACGACGTGCTGCGCAACCCTCCGACGCTTCGCCGGCCGCGCAGGTGGATCTACGCACGCTCGGCTACAGCCAGCAGCAACAGGAGAAGATCAAACCGAAGGTTCGTTCGACAGTGGCGCAGCACCACGAGGCACTGGTCGGCCATGGGTTTACACACGCGCACATCGTTGCGCTCAGCCAACACCCGGCAGCGTTAGGGACCGTCGCTGTCAAGTATCAGGACATGATCGCAGCGTTGCCAGAGGCGACACACGAAGCGATCGTTGGCGTCGGCAAACAGTGGTCCGGCGCACGCGCTCTGGAGGCCTTGCTCACGGTGGCGGGAGAGTTGAGAGGTCCACCGTTACAGTTGGACACAGGCCAACTTCTCAAGATTGCAAAACGTGGCGGCGTGACCGCAGTGGAGGCAGTGCATGCATGGCGCAATGCACTGACGGGTGCCCCCCTGAACCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATAGCGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCAATAGCGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCAATAGCGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATGGCGGCGGCAGGCCGGCGCTGGAGAGCATTGTTGCCCAGTTATCTCGCCCTGATCCGGCGTTGGCCGCGTTGACCAACGACCACCTCGTCGCCTTGGCCTGCCTCGGCGGACGTCCTGCGCTGGATGCAGTGAAAAAGGGATTGCCGCACGCGCCGGCCTTGATCAAAAGAACCAATCGCCGTATTCCCGAACGCACATCCCATCGCGTTGCCGACCACGCGCAAGTGGTTCGCGTGCTGGGTTTTTTCCAGTGCCACTCCCACCCAGCGCAAGCATTTGATGACGCCATGACGCAGTTCGGGATGAGCAGGCACGGGTTGTTACAGCTCTTTCGCAGAGTGGGCGTCACCGAACTCGAAGCCCGCAGTGGAACGCTCCCCCCAGCCTCGCAGCGTTGGGACCGTATCCTCCAGGCATCAGGGATGAAAAGGGCCAAACCGTCCCCTACTTCAACTCAAACGCCGGATCAGGCGTCTTTGCATGCATTCGCCGATTCGCTGGAGCGTGACCTTGATGCGCCTAGCCCAATGCACGAGGGAGATCAGACGCGGGCAAGCAGCCGTAAACGGTCCCGATCGGATCGTGCTGTCACCGGTCCCTCCGCACAGCAATCGTTCGAGGTGCGCGTTCCCGAACAGCGCGATGCGCTGCATTTGCCCCTCAGTTGGAGGGTAAAACGCCCGCGTACCAGTATCGGGGGCGGCCTCCCGGATCCTGGTACGCCCACGGCTGCCGACCTGGCAGCGTCCAGCACCGTGATGCGGGAACAAGATGAGGACCCCTTCGCAGGGGCAGCGGATGATTTCCCGGCATTCAACGAAGAGGAGCTCGCATGGTTGATGGAGCTATTGCCTCAGTGAGGCTCAGTCGGTGACTACCTGAGCGTCTGCAGGGATTGGTGTAAGTAACCTTTACTGACAGCGAGTTAGCC CAGGGATTGGTGTAAGTAACCTTTACTGACAGCGAGTTAGCC
Has Description Xanthomonas campestris pv. armoraciae Hax4 (hax4) gene, complete cds
Has GenBank ID 66270060  +
Has GenBank Locus AY993939  +
Has Name Hax4  +
Is Gene Type Avirulence Genes +
Is from DB true  +
Is in Species Species:Xanthomonas campestris +
SameAs http://bio2rdf.org/page/geneid:66270060  +
Creation dateThis property is a special property in this wiki. 7 August 2012 14:09:58  +
Categories Avirulence Genes, manually curated  +
Last editor isThis property is a special property in this wiki. User:Cepabot +
Modification dateThis property is a special property in this wiki. 7 August 2012 14:09:58  +
hide properties that link here 
Gene:PRGDB00000031#20 + Has AVR Gene
 

 

Enter the name of the page to start browsing from.
Personal tools
Namespaces

Variants
Views
Actions
PRGDB
META-SPECIES
Wiki
Toolbox