Browse wiki

Jump to: navigation, search
Gene:PRGAV00000032
Has DNA Sequence CTCCGCCCAACATTCGACAATTCTCAACATGAAGCTCTTCAT CTCCGCCCAACATTCGACAATTCTCAACATGAAGCTCTTCATACTGACCTTCATTTGGCTACTTACCGCATCCGAAGTAATAGCAGCAGCCAAAAAACTACCTGGCTGCGACAAAGATCCTTGCAAAGTGAAGGAGAAGTCTGGAAAGTATAAATTGAAGATTGGTGCTAAATGCTCGGCGACATGTGACGGGAAGTTGACGAGGGGAGGAACGTGTGAGAATGTGCAGGGTAATCACCTTTGCTGTTTTGGTCTTTGCGGTTGATGAATGTCAGCTGTGGCATCAGAACGGGGATTGCGCGAACGATTTTGGATGGAGACAGTGTGAGAAGAGTATGCTAAGCGATGGGATCAATAGGTACTTCGCTTGTACCCAGATCTGCCTCAATTTTTTTATGTCCCAAAAAAAAAAAAA CCAGATCTGCCTCAATTTTTTTATGTCCCAAAAAAAAAAAAA
Has Description Cladosporium fulvum mRNA for AVR2 protein
Has GenBank ID 22474460  +
Has GenBank Locus AJ421629  +
Has Name Avr2  +
Is Gene Type Avirulence Genes +
Is from DB true  +
Is in Species Species:Passalora fulva +
SameAs http://bio2rdf.org/page/geneid:22474460  +
Creation dateThis property is a special property in this wiki. 7 August 2012 14:10:00  +
Categories Avirulence Genes, manually curated  +
Last editor isThis property is a special property in this wiki. User:Cepabot +
Modification dateThis property is a special property in this wiki. 7 August 2012 14:10:00  +
hide properties that link here 
Gene:PRGDB00000032#59 + Has AVR Gene
 

 

Enter the name of the page to start browsing from.
Personal tools
Namespaces

Variants
Views
Actions
PRGDB
META-SPECIES
Wiki
Toolbox