Browse wiki

Jump to: navigation, search
Gene:PRGAV00000039
Has DNA Sequence ATGGAAGCAAATACATATCTCAACGCAATCATACTTGTGCTT ATGGAAGCAAATACATATCTCAACGCAATCATACTTGTGCTTGTGGTAACAATCATAGCAGTCATTAGTACTTCCTTAGTGAGGACTGAACCTTGTGTCATCAAGATTACTGGAGAATCAATCACAGTGTTGGCTTGCAAATTAGATGCAGAAACCATCAGAGCCATCGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGATGTCAGCACCAGCTAGCACAACACAGGCCACAGGGTCAACTACCTCAACTACCGCAAAAACTGCAGGCGCAACTCCTGCCACAGCTTCAGGACTGTTCACCATCCCGGATGGGGATTTCTTTAGTACAGCCCGCGCTATAGTAGCCAGCAATGCCGTTGCAACAAATGAGGACCTCAGCAAGATTGAGGCTATCTGGAAGGACATGAAGGTGCCCACAGACACTATGGCACAGGCTGCCTGGGACTTAGTCAGACACTGCGCTGACGTGGGCTCATCTGCTCAAACAGAAATGATAGATACAGGTCCCTATTCCAACGGCATCAGCAGAGCCAGACTGGCAGCAGCAATTAAAGAGGTGTGCATACTTAGGCAATTTTGCATGAAGTATGCCCCAGTGGTATGGAACTGGATGCTGACTAACAACAGTCCACCTGCTAACTGGCAAGCACAAGGCTTCAAGCCTGAGCACAAATTCGCTGCATTCGACTTCTTCAATGGAGTCACCAACCCAGCTGCCATCATGCCCAAAGAGGGGCTCATCCGGCCACCGTCTGAAGCTGAAATGAATGCTGCCCAAACTGCTGCCTTTGTGAAGATTACGAAGGCCAGGGCACAATCCAACGACTTTGCCAGCCTAGATGCAGCTGTCACTCGAGGTCGTATCACTGGAACAACAACCGCTGAGGCTGTTGTCACTCTCCCACCACCATAA ACAACAACCGCTGAGGCTGTTGTCACTCTCCCACCACCATAA
Has Description Potato virus X 8 kDa protein and coat protein (CP) genes, complete cds
Has GenBank ID 22671712  +
Has GenBank Locus AF535157  +
Has Name CP  +
Is Gene Type Avirulence Genes +
Is from DB true  +
Is in Species Species:Potato virus X +
SameAs http://bio2rdf.org/page/geneid:22671712  +
Creation dateThis property is a special property in this wiki. 7 August 2012 14:10:07  +
Categories Avirulence Genes, manually curated  +
Last editor isThis property is a special property in this wiki. User:Cepabot +
Modification dateThis property is a special property in this wiki. 7 August 2012 14:10:07  +
hide properties that link here 
Gene:PRGDB00000050#14 + , Gene:PRGDB00000050#15 + , Gene:PRGDB00000051#14 + , Gene:PRGDB00000051#15 + Has AVR Gene
 

 

Enter the name of the page to start browsing from.
Personal tools
Namespaces

Variants
Views
Actions
PRGDB
META-SPECIES
Wiki
Toolbox